Human BFAR(Bifunctional Apoptosis Regulator) ELISA Kit

Human BFAR(Bifunctional Apoptosis Regulator) ELISA Kit

To Order Contact us: 

Human Bifunctional Apoptosis Regulator (BFAR) ELISA Kit

abx384630-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Bifunctional Apoptosis Regulator (BFAR) ELISA Kit

SEJ556Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bifunctional Apoptosis Regulator (BFAR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bifunctional Apoptosis Regulator (BFAR) in Tissue homogenates, cell lysates and other biological fluids.

Human Bifunctional Apoptosis Regulator (BFAR) ELISA Kit

SEJ556Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bifunctional Apoptosis Regulator (BFAR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bifunctional Apoptosis Regulator (BFAR) in Tissue homogenates, cell lysates and other biological fluids.

Human Bifunctional Apoptosis Regulator (BFAR) ELISA Kit

SEJ556Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bifunctional Apoptosis Regulator (BFAR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bifunctional Apoptosis Regulator (BFAR) in Tissue homogenates, cell lysates and other biological fluids.

Human Bifunctional Apoptosis Regulator (BFAR) ELISA Kit

SEJ556Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bifunctional Apoptosis Regulator (BFAR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bifunctional Apoptosis Regulator (BFAR) in Tissue homogenates, cell lysates and other biological fluids.

Human Bifunctional Apoptosis Regulator (BFAR) ELISA Kit

4-SEJ556Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Bifunctional Apoptosis Regulator elisa. Alternative names of the recognized antigen: BAR
  • RNF47
  • RING finger protein 47
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bifunctional Apoptosis Regulator (BFAR) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Bifunctional Apoptosis Regulator (BFAR) Antibody

20-abx006121
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bifunctional Apoptosis Regulator (BFAR) Antibody

abx029013-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Bifunctional Apoptosis Regulator (BFAR) Antibody

abx029013-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Bifunctional Apoptosis Regulator (BFAR) Antibody

20-abx320837
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bifunctional Apoptosis Regulator (BFAR) Antibody

20-abx339261
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Bifunctional Apoptosis Regulator (BFAR) Antibody

20-abx339262
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Goat Bifunctional apoptosis regulator(BFAR) ELISA kit

E06B0794-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bifunctional apoptosis regulator(BFAR) ELISA kit

E06B0794-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Bifunctional apoptosis regulator(BFAR) ELISA kit

E06B0794-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bifunctional apoptosis regulator(BFAR) ELISA kit

E02B0794-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bifunctional apoptosis regulator(BFAR) ELISA kit

E02B0794-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Bifunctional apoptosis regulator(BFAR) ELISA kit

E02B0794-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bifunctional apoptosis regulator(BFAR) ELISA kit

E03B0794-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bifunctional apoptosis regulator(BFAR) ELISA kit

E03B0794-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bifunctional apoptosis regulator(BFAR) ELISA kit

E03B0794-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bifunctional apoptosis regulator(BFAR) ELISA kit

E04B0794-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bifunctional apoptosis regulator(BFAR) ELISA kit

E04B0794-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Bifunctional apoptosis regulator(BFAR) ELISA kit

E04B0794-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bifunctional apoptosis regulator(BFAR) ELISA kit

E07B0794-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bifunctional apoptosis regulator(BFAR) ELISA kit

E07B0794-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Bifunctional apoptosis regulator(BFAR) ELISA kit

E07B0794-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bifunctional apoptosis regulator(BFAR) ELISA kit

E09B0794-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bifunctional apoptosis regulator(BFAR) ELISA kit

E09B0794-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Bifunctional apoptosis regulator(BFAR) ELISA kit

E09B0794-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bifunctional apoptosis regulator(BFAR) ELISA kit

E08B0794-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bifunctional apoptosis regulator(BFAR) ELISA kit

E08B0794-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Bifunctional apoptosis regulator(BFAR) ELISA kit

E08B0794-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Bifunctional apoptosis regulator, Bfar ELISA KIT

ELI-12043m 96 Tests
EUR 865

Mouse Bifunctional Apoptosis Regulator (BFAR) ELISA Kit

abx388682-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Bifunctional Apoptosis Regulator (BFAR) ELISA Kit

abx391020-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Bifunctional Apoptosis Regulator (BFAR) CLIA Kit

20-abx495734
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 Ă— 96 tests
  • 5 Ă— 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human BFAR (Bifunctional Apoptosis Regulator)

ELK5173 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bifunctional Apoptosis Regulator (BFAR). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specif
  • Show more
Description: A sandwich ELISA kit for detection of Bifunctional Apoptosis Regulator from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Bifunctional apoptosis regulator(BFAR) ELISA kit

E05B0794-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Bifunctional apoptosis regulator(BFAR) ELISA kit

E05B0794-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Bifunctional apoptosis regulator(BFAR) ELISA kit

E05B0794-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Bifunctional apoptosis regulator(BFAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bfar ELISA Kit| Rat Bifunctional apoptosis regulator ELISA Kit

EF018373 96 Tests
EUR 689

Bfar ELISA Kit| Mouse Bifunctional apoptosis regulator ELISA Ki

EF014307 96 Tests
EUR 689

Bifunctional Apoptosis Regulator (BAR) Antibody

20-abx142064
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Apoptosis regulator BAX ELISA kit

E01A1782-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apoptosis regulator BAX ELISA kit

E01A1782-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apoptosis regulator BAX ELISA kit

E01A1782-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Apoptosis regulator BAX ELISA Kit

CSB-E09344h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Apoptosis regulator BAX in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Apoptosis regulator BAX ELISA Kit

1-CSB-E09344h
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Apoptosis regulator BAX in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Bfar/ Rat Bfar ELISA Kit

ELI-34715r 96 Tests
EUR 886

Human BAX/ Apoptosis regulator BAX ELISA Kit

E0254Hu 1 Kit
EUR 563

Human BAX(Apoptosis regulator BAX) ELISA Kit

EH0669 96T
EUR 524.1
  • Detection range: 0.781-50 ng/ml
  • Uniprot ID: Q07812
  • Alias: BAX/apoptosis regulator BAX/BCL2-associated X protein/Bcl2-L-4/BCL2L4bcl2-L-4/Bcl-2-like protein 4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Apoptosis regulator BAX, BAX ELISA KIT

ELI-04433h 96 Tests
EUR 824

Goat Apoptosis regulator BAX ELISA kit

E06A1782-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Apoptosis regulator BAX ELISA kit

E06A1782-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Apoptosis regulator BAX ELISA kit

E06A1782-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Apoptosis regulator BAX ELISA kit

E03A1782-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Apoptosis regulator BAX ELISA kit

E03A1782-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Apoptosis regulator BAX ELISA kit

E03A1782-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Apoptosis regulator BAX ELISA kit

E04A1782-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Apoptosis regulator BAX ELISA kit

E04A1782-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Apoptosis regulator BAX ELISA kit

E04A1782-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apoptosis regulator BAX ELISA kit

E02A1782-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apoptosis regulator BAX ELISA kit

E02A1782-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Apoptosis regulator BAX ELISA kit

E02A1782-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Apoptosis regulator BAX ELISA kit

E07A1782-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Apoptosis regulator BAX ELISA kit

E07A1782-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Apoptosis regulator BAX ELISA kit

E07A1782-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Apoptosis regulator BAX ELISA kit

E09A1782-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Apoptosis regulator BAX ELISA kit

E09A1782-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Apoptosis regulator BAX ELISA kit

E09A1782-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Apoptosis regulator BAX ELISA kit

E08A1782-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Apoptosis regulator BAX ELISA kit

E08A1782-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Apoptosis regulator BAX ELISA kit

E08A1782-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

BFAR ELISA KIT|Human

EF004666 96 Tests
EUR 689

Human BCL2/ Apoptosis regulator Bcl-2 ELISA Kit

E0261Hu 1 Kit
EUR 563

ELISA kit for Human Apoptosis regulator Bcl-2

EK2237 96 tests
EUR 536
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Apoptosis regulator Bcl-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Apoptosis regulator Bcl- 2, BCL2 ELISA KIT

ELI-02659h 96 Tests
EUR 824

Guinea pig Apoptosis regulator BAX ELISA kit

E05A1782-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Apoptosis regulator BAX ELISA kit

E05A1782-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Apoptosis regulator BAX ELISA kit

E05A1782-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Apoptosis regulator BAX in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine BAX/ Apoptosis regulator BAX ELISA Kit

E0294Bo 1 Kit
EUR 717

ELISA kit for Bovine Apoptosis regulator BAX

EK3223 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Apoptosis regulator BAX in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Apoptosis regulator BAX

EK3224 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Apoptosis regulator BAX in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse Apoptosis regulator BAX

EK3225 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Apoptosis regulator BAX in samples from serum, plasma, tissue homogenates and other biological fluids.

Bovine Apoptosis regulator BAX, BAX ELISA KIT

ELI-04430b 96 Tests
EUR 928

Mouse Apoptosis regulator BAX, Bax ELISA KIT

ELI-04432m 96 Tests
EUR 865

Rat Bax(Apoptosis regulator BAX) ELISA Kit

ER0512 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q63690
  • Alias: Bax/apoptosis regulator BAX/BCL2-associated X protein/Bcl2-L-4/BCL2L4bcl2-L-4/Bcl-2-like protein 4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

Mouse Bax(Apoptosis regulator BAX) ELISA Kit

EM0584 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q07813
  • Alias: Bax/BAX/apoptosis regulator BAX/BCL2-associated X protein/Bcl2-L-4/BCL2L4bcl2-L-4/Bcl-2-like protein 4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Rat Apoptosis regulator BAX(BAX) ELISA kit

CSB-EL002573RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Apoptosis regulator BAX (BAX) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Apoptosis regulator BAX(BAX) ELISA kit

1-CSB-EL002573RA
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Apoptosis regulator BAX(BAX) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Bax/ Apoptosis regulator BAX ELISA Kit

E0117Ra 1 Kit
EUR 571

Mouse Bax/ Apoptosis regulator BAX ELISA Kit

E0162Mo 1 Kit
EUR 571

Rat Apoptosis regulator BAX(BAX) ELISA kit

QY-E11670 96T
EUR 374

Bax ELISA Kit| Rat Apoptosis regulator BAX ELISA Kit

EF017349 96 Tests
EUR 689

Bax ELISA Kit| Mouse Apoptosis regulator BAX ELISA Kit

EF013208 96 Tests
EUR 689

Human PAWR(PRKC apoptosis WT1 regulator protein) ELISA Kit

EH10908 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q96IZ0
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human PRKC apoptosis WT1 regulator protein, PAWR ELISA KIT

ELI-35406h 96 Tests
EUR 824

Human PRKC apoptosis WT1 regulator protein(PAWR) ELISA kit

CSB-EL017486HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human PRKC apoptosis WT1 regulator protein (PAWR) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human PRKC apoptosis WT1 regulator protein(PAWR) ELISA kit

1-CSB-EL017486HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human PRKC apoptosis WT1 regulator protein(PAWR) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Bovine BCL2/ Apoptosis regulator Bcl-2 ELISA Kit

E0295Bo 1 Kit
EUR 717

ELISA kit for Rat Apoptosis regulator Bcl-2

EK2236 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Apoptosis regulator Bcl-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse Apoptosis regulator Bcl-2

EK2238 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Apoptosis regulator Bcl-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Bovine Apoptosis regulator Bcl-2

EK2239 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Apoptosis regulator Bcl-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Bcl2/ Apoptosis regulator Bcl-2 ELISA Kit

E1054Ra 1 Kit
EUR 571

Mouse Apoptosis regulator Bcl- 2, Bcl2 ELISA KIT

ELI-02656m 96 Tests
EUR 865

Chicken Apoptosis regulator Bcl- 2, BCL2 ELISA KIT

ELI-02657c 96 Tests
EUR 928

Bovine Apoptosis regulator Bcl- 2, BCL2 ELISA KIT

ELI-02658b 96 Tests
EUR 928

Mouse Bcl2(Apoptosis regulator Bcl-2) ELISA Kit

EM0454 96T
EUR 476.25
  • Detection range: 1.563-100 ng/ml
  • Uniprot ID: P10417
  • Alias: Bcl2/Bcl-2/apoptosis regulator Bcl-2/B-cell CLL/lymphoma 2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.938 ng/ml

Mouse Bcl2/ Apoptosis regulator Bcl-2 ELISA Kit

E0169Mo 1 Kit
EUR 571

ELISA kit for Rat Apoptosis regulator BAX (BAX)

KTE101125-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Rat Apoptosis regulator BAX (BAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Apoptosis regulator BAX (BAX)

KTE101125-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Rat Apoptosis regulator BAX (BAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Apoptosis regulator BAX (BAX)

KTE101125-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Rat Apoptosis regulator BAX (BAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Apoptosis regulator BAX (BAX)

KTE10421-48T 48T
EUR 354
  • Bax (Bcl-2 associated x protein) is an apoptosis regulating protein of the Bcl-2 family. The ratio of Bax to Bcl-2 determines survival or death following an apoptotic stimulus. Bax is implicated in many cancers, uterine leiomyomas, and brain dysmorph
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Apoptosis regulator BAX (BAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Apoptosis regulator BAX (BAX)

KTE10421-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Bax (Bcl-2 associated x protein) is an apoptosis regulating protein of the Bcl-2 family. The ratio of Bax to Bcl-2 determines survival or death following an apoptotic stimulus. Bax is implicated in many cancers, uterine leiomyomas, and brain dysmorph
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Apoptosis regulator BAX (BAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Apoptosis regulator BAX (BAX)

KTE10421-96T 96T
EUR 572
  • Bax (Bcl-2 associated x protein) is an apoptosis regulating protein of the Bcl-2 family. The ratio of Bax to Bcl-2 determines survival or death following an apoptotic stimulus. Bax is implicated in many cancers, uterine leiomyomas, and brain dysmorph
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Apoptosis regulator BAX (BAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Apoptosis regulator Bcl-2 (BCL2)

1-CSB-EP002611HU1
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 25.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Apoptosis regulator Bcl-2(BCL2),partial expressed in E.coli

Recombinant human Apoptosis regulator Bcl-2

P1614 100ug Ask for price
  • Uniprot ID: P10415
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Apoptosis regulator Bcl-2

Bcl2 ELISA Kit| Porcine Apoptosis regulator Bcl-2 ELISA Kit

EF016749 96 Tests
EUR 689

Bcl2 ELISA Kit| Mouse Apoptosis regulator Bcl-2 ELISA Kit

EF013101 96 Tests
EUR 689

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

abx576585-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human CFLAR/ CASP8 and FADD-like apoptosis regulator ELISA Kit

E0484Hu 1 Kit
EUR 605

Human CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E01C1637-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Human CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E01C1637-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Human CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E01C1637-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Human CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human CASP8 and FADD-like apoptosis regulator

EK3645 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CASP8 and FADD-like apoptosis regulator in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CFLAR(CASP8 and FADD-like apoptosis regulator) ELISA Kit

EH1762 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: O15519
  • Alias: CFLAR/CASP8 and FADD-like apoptosis regulator/Inhibitor of FLICE/I-FLICE/FADD-like antiapoptotic molecule 1/FLAME-1/Cellular FLICE-like inhibitory protein/c-FLIP/Caspase-like apoptosis regulato
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human CASP8 and FADD- like apoptosis regulator, CFLAR ELISA KIT

ELI-24874h 96 Tests
EUR 824

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

20-abx258174
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 Ă— 96 tests
  • 5 Ă— 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

DLR-CFLAR-Hu-48T 48T
EUR 554
  • Should the Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) in samples from tissue homogenates, cell lysates or other biological fluids.

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

DLR-CFLAR-Hu-96T 96T
EUR 725
  • Should the Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) in samples from tissue homogenates, cell lysates or other biological fluids.

Human CASP8 And FADD Like Apoptosis Regulator ELISA Kit (CFLAR)

RK01099 96 Tests
EUR 521

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

RD-CFLAR-Hu-48Tests 48 Tests
EUR 563

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

RD-CFLAR-Hu-96Tests 96 Tests
EUR 783

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

RDR-CFLAR-Hu-48Tests 48 Tests
EUR 589

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

RDR-CFLAR-Hu-96Tests 96 Tests
EUR 820

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

SEL332Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) in Tissue homogenates, cell lysates and other biological fluids.

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

SEL332Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) in Tissue homogenates, cell lysates and other biological fluids.

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

SEL332Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) in Tissue homogenates, cell lysates and other biological fluids.

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

SEL332Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) in Tissue homogenates, cell lysates and other biological fluids.

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

4-SEL332Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as CASP8 And FADD Like Apoptosis Regulator elisa. Alternative names of the recognized antigen: CASH
  • CASP8AP1
  • CLARP
  • Casper
  • FLAME1
  • FLIP
  • I-FLICE
  • MRIT
  • USURPIN
  • c-FLIP
  • c-FLIPL
  • c-FLIPR
  • c-FLIPS
  • Caspase-eight-related protein
  • FADD-like
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

BCL2, Apoptosis Regulator (BCL2) Antibody

20-abx159344
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse PRKC apoptosis WT1 regulator protein, Pawr ELISA KIT

ELI-35758m 96 Tests
EUR 865

TranslationBlocker Human Apoptosis regulator BAX siRNA, 10nmol

QX6-10nmol 10nmol
EUR 377

TranslationBlocker Human Apoptosis regulator BAX siRNA, 2nmol

QX6-2nmol 2nmol
EUR 276

ELISA kit for Human CFLAR (CASP8 And FADD Like Apoptosis Regulator)

ELK7503 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to CASP8 And FADD Like Apoptosis Regulator (CFLAR). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibod
  • Show more
Description: A sandwich ELISA kit for detection of CASP8 And FADD Like Apoptosis Regulator from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Cell Division Cycle and Apoptosis Regulator 1 (CCAR1) ELISA Kit

abx384689-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Cell Cycle And Apoptosis Regulator 2 / KIAA1967 (CCAR2) ELISA Kit

20-abx386324
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 Ă— 96 tests
  • 5 Ă— 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

PRKC, Apoptosis, WT1, Regulator (PAWR) Antibody

20-abx114680
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-X (BCLX) Antibody

20-abx121848
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-W (BCLW) Antibody

20-abx007571
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-W (BCL2L2) Antibody

20-abx014015
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

PRKC, Apoptosis, WT1, Regulator (PAWR) Antibody

20-abx328356
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

PRKC, Apoptosis, WT1, Regulator (PAWR) Antibody

20-abx339924
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

PRKC, Apoptosis, WT1, Regulator (PAWR) Antibody

abx332457-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-2 (BCL2) Antibody

20-abx302283
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PRKC, Apoptosis, WT1, Regulator (PAWR) Antibody

20-abx211370
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-G (BCL2L14) Antibody

20-abx225061
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-2 (BCL2) Antibody

abx230839-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Apoptosis regulator Bcl-2 Polyclonal Antibody

42081-100ul 100ul
EUR 333

Mouse Apoptosis regulator Bcl-2 (Bcl2)

1-CSB-EP002611MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 26.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Apoptosis regulator Bcl-2(Bcl2),partial expressed in E.coli

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Mouse CASP8 And FADD Like Apoptosis Regulator (CFLAR) ELISA Kit

abx555890-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Goat CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E06C1637-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Goat CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E06C1637-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Goat CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E06C1637-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Goat CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cflar/ CASP8 and FADD-like apoptosis regulator ELISA Kit

E0280Mo 1 Kit
EUR 632

Rat CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E02C1637-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Rat CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E02C1637-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Rat CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E02C1637-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Rat CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E03C1637-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Mouse CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E03C1637-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Mouse CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E03C1637-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Mouse CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E04C1637-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Rabbit CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E04C1637-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Rabbit CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E04C1637-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Rabbit CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E07C1637-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Porcine CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E07C1637-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Porcine CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E07C1637-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Porcine CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E08C1637-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Canine CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E08C1637-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Canine CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E08C1637-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Canine CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E09C1637-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Monkey CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E09C1637-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Monkey CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E09C1637-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Monkey CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Cflar ELISA Kit| Mouse CASP8 and FADD-like apoptosis regulator

EF014415 96 Tests
EUR 689

Mouse CASP8 and FADD- like apoptosis regulator, Cflar ELISA KIT

ELI-50881m 96 Tests
EUR 865

BFAR siRNA

20-abx900627
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BFAR siRNA

20-abx909068
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BFAR siRNA

20-abx909069
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BFAR Antibody

37153-100ul 100ul
EUR 252

BFAR Antibody

25048-100ul 100ul
EUR 390

BFAR Antibody

1-CSB-PA002678ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BFAR. Recognizes BFAR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

BFAR Antibody

1-CSB-PA239397
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BFAR. Recognizes BFAR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

BFAR Antibody

1-CSB-PA217827
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BFAR. Recognizes BFAR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

Human Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E01C1426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E01C1426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E01C1426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Apoptosis Regulator Bcl-2 (C-6His)

CR22-10ug 10ug
EUR 146
Description: Supplied as a 0.2 ÎĽm filtered solution of 20mM HEPES, 150mM NaCl, 10%Glycerol, pH8.0.

Recombinant Human Apoptosis Regulator Bcl-2 (C-6His)

CR22-1mg 1mg
EUR 1674
Description: Supplied as a 0.2 ÎĽm filtered solution of 20mM HEPES, 150mM NaCl, 10%Glycerol, pH8.0.

Recombinant Human Apoptosis Regulator Bcl-2 (C-6His)

CR22-500ug 500ug
EUR 1186
Description: Supplied as a 0.2 ÎĽm filtered solution of 20mM HEPES, 150mM NaCl, 10%Glycerol, pH8.0.

Recombinant Human Apoptosis Regulator Bcl-2 (C-6His)

CR22-50ug 50ug
EUR 303
Description: Supplied as a 0.2 ÎĽm filtered solution of 20mM HEPES, 150mM NaCl, 10%Glycerol, pH8.0.

Human CASP8 And FADD Like Apoptosis Regulator (CFLAR) CLIA Kit

20-abx495915
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 Ă— 96 tests
  • 5 Ă— 96 tests
  • 96 tests
  • Please enquire.

Human BFAR shRNA Plasmid

20-abx959661
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BFAR Recombinant Protein (Human)

RP003019 100 ug Ask for price

Guinea pig CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E05C1637-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Guinea pig CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E05C1637-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Guinea pig CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig CASP8 and FADD like apoptosis regulator(CFLAR) ELISA kit

E05C1637-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive for quantitative measurement of Guinea pig CASP8 and FADD like apoptosis regulator(CFLAR) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cell Division Cycle and Apoptosis Regulator 1 (CCAR1) ELISA Kit

abx388828-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Apoptosis regulator Bcl-2 Polyclonal Conjugated Antibody

C42081 100ul
EUR 397

BCL2 Associated X, Apoptosis Regulator (BAX) Antibody

20-abx159342
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

BCL2 Associated X, Apoptosis Regulator (BAX) Antibody

20-abx159343
  • EUR 272.00
  • EUR 230.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-X (BCL-XL) Antibody

20-abx011694
  • EUR 439.00
  • EUR 91.00
  • 100 ug
  • 10 ug
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-X (BCL-XL) Antibody

abx011696-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-2 (BCL2) Antibody (HRP)

20-abx316130
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-2 (BCL2) Antibody (FITC)

20-abx316131
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-2 (BCL2) Antibody (Biotin)

20-abx316132
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CASP8 and FADD-Like Apoptosis Regulator Protein

20-abx261489
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Apoptosis Regulator Bcl-X (BCL-XL) Antibody

abx412040-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

Epstein-Barr virus Apoptosis regulator BHRF1 (BHRF1)

1-CSB-EP314488EFC
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 19.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Epstein-Barr virus Apoptosis regulator BHRF1(BHRF1),partial expressed in E.coli

TranslationBlocker Mouse Apoptosis regulator BAX siRNA, 10nmol

QX9-10nmol 10nmol
EUR 377

TranslationBlocker Mouse Apoptosis regulator BAX siRNA, 2nmol

QX9-2nmol 2nmol
EUR 276

Human Bifunctional protein NCOAT(MGEA5) ELISA kit

E01B0947-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bifunctional protein NCOAT(MGEA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bifunctional protein NCOAT(MGEA5) ELISA kit

E01B0947-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bifunctional protein NCOAT(MGEA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Bifunctional protein NCOAT(MGEA5) ELISA kit

E01B0947-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Bifunctional protein NCOAT(MGEA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MGEA5/ Bifunctional protein NCOAT ELISA Kit

E2932Hu 1 Kit
EUR 605

Human Peroxisomal bifunctional enzyme, EHHADH ELISA KIT

ELI-47170h 96 Tests
EUR 824

Recombinant human Cell cycle and apoptosis regulator protein 2

P1525 100ug Ask for price
  • Uniprot ID: Q8N163
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Cell cycle and apoptosis regulator protein 2

Human Autoimmune Regulator ELISA kit

E01A0527-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Autoimmune Regulator in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Autoimmune Regulator ELISA kit

E01A0527-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Autoimmune Regulator in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Autoimmune Regulator ELISA kit

E01A0527-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Autoimmune Regulator in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

BFAR Conjugated Antibody

C37153 100ul
EUR 397

Polyclonal BFAR Antibody

APR06603G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BFAR . This antibody is tested and proven to work in the following applications:

BFAR cloning plasmid

CSB-CL002678HU-10ug 10ug
EUR 233
  • Formulation: 10 ĂŽÂĽg plasmid + 200ĂŽÂĽl Glycerol
  • Length: 1353
  • Sequence: atggaggaacctcagaaaagctatgtgaacacaatggaccttgagagagatgaacctctcaaaagcaccggccctcagatttctgttagtgaattttcttgccactgctgctacgacatcctggttaaccccaccaccttgaactgtgggcacagcttctgccgtcactgccttg
  • Show more
Description: A cloning plasmid for the BFAR gene.

BFAR Rabbit pAb

A8308-100ul 100 ul
EUR 308

BFAR Rabbit pAb

A8308-200ul 200 ul
EUR 459

BFAR Rabbit pAb

A8308-20ul 20 ul
EUR 183

BFAR Rabbit pAb

A8308-50ul 50 ul
EUR 223

Anti-BFAR antibody

STJ110606 100 µl
EUR 277

Anti-BFAR (1C6)

YF-MA18461 200 ul
EUR 363
Description: Mouse monoclonal to BFAR

Anti-BFAR (1C6)

YF-MA11501 50 ug
EUR 363
Description: Mouse monoclonal to BFAR

Goat Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E06C1426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E06C1426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E06C1426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E02C1426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E02C1426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E02C1426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cell division cycle and apoptosis regulator protein 1(CCAR1) ELISA kit

E03C1426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Cell division cycle and apoptosis regulator protein 1(CCAR1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.