Human CRBN(Cereblon) ELISA Kit

Human CRBN(Cereblon) ELISA Kit

To Order Contact us: 

    Human Cereblon (CRBN) ELISA Kit
    RDR-CRBN-Hu-96Tests 96 Tests
    EUR 756
    Human Cereblon (CRBN) ELISA Kit
    RD-CRBN-Hu-48Tests 48 Tests
    EUR 521
    Human Cereblon (CRBN) ELISA Kit
    RD-CRBN-Hu-96Tests 96 Tests
    EUR 723
    Mouse Cereblon (CRBN) ELISA Kit
    DLR-CRBN-Mu-48T 48T
    EUR 527
    • Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids.
    Mouse Cereblon (CRBN) ELISA Kit
    DLR-CRBN-Mu-96T 96T
    EUR 688
    • Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids.
    Mouse Cereblon (CRBN) ELISA Kit
    RDR-CRBN-Mu-48Tests 48 Tests
    EUR 557
    Mouse Cereblon (CRBN) ELISA Kit
    RDR-CRBN-Mu-96Tests 96 Tests
    EUR 774
    Mouse Cereblon (CRBN) ELISA Kit
    RD-CRBN-Mu-48Tests 48 Tests
    EUR 533
    Mouse Cereblon (CRBN) ELISA Kit
    RD-CRBN-Mu-96Tests 96 Tests
    EUR 740
    Human Cereblon (CRBN)ELISA Kit
    201-12-2889 96 tests
    EUR 440
    • This Cereblon ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Cereblon (CRBN) ELISA Kit
    20-abx151037
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Cereblon(CRBN)ELISA Kit
    QY-E05053 96T
    EUR 400
    Human Cereblon ELISA Kit (CRBN)
    RK01182 96 Tests
    EUR 521
    Human Cereblon (CRBN) ELISA Kit
    SEG676Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.
    Human Cereblon (CRBN) ELISA Kit
    SEG676Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.
    Human Cereblon (CRBN) ELISA Kit
    SEG676Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.
    Human Cereblon (CRBN) ELISA Kit
    SEG676Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.
    Human Cereblon (CRBN) ELISA Kit
    4-SEG676Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
    • Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cereblon (CRBN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Mouse Cereblon (CRBN) ELISA Kit
    20-abx153810
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Mouse Cereblon (CRBN) ELISA Kit
    SEG676Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4862.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.
    Mouse Cereblon (CRBN) ELISA Kit
    SEG676Mu-1x48wellstestplate 1x48-wells test plate
    EUR 488.08
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.
    Mouse Cereblon (CRBN) ELISA Kit
    SEG676Mu-1x96wellstestplate 1x96-wells test plate
    EUR 654.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.
    Mouse Cereblon (CRBN) ELISA Kit
    SEG676Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2644.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.
    Mouse Cereblon (CRBN) ELISA Kit
    4-SEG676Mu
    • EUR 4913.00
    • EUR 2595.00
    • EUR 655.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
    • Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Cereblon (CRBN) in samples from Tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Cereblon (CRBN) Antibody
    20-abx175781
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Cereblon (CRBN) Antibody
    20-abx175782
    • EUR 1233.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Cereblon (CRBN) Antibody
    20-abx175783
    • EUR 1233.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Cereblon (CRBN) Antibody
    20-abx111556
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Cereblon (CRBN) Antibody
    20-abx171671
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Human CRBN/ Protein cereblon ELISA Kit
    E0552Hu 1 Kit
    EUR 605
    Human Protein cereblon (CRBN) ELISA Kit
    abx250736-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human CRBN(Protein cereblon) ELISA Kit
    EH1457 96T
    EUR 567.6
    • Detection range: 0.312-20 ng/ml
    • Uniprot ID: Q96SW2
    • Alias: CRBN/Protein cereblon/DKFZp781K0715/MGC27358/MRT2A/AD-006
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
    Human Protein cereblon, CRBN ELISA KIT
    ELI-10494h 96 Tests
    EUR 824
    ELISA kit for Human CRBN (Cereblon)
    ELK4870 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
    • Show more
    Description: A sandwich ELISA kit for detection of Cereblon from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Human Cereblon (CRBN) CLIA Kit
    20-abx495269
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Human Cereblon (CRBN) Protein
    20-abx652846
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Human Protein cereblon (CRBN)
    1-CSB-BP842761HU
    • EUR 761.00
    • EUR 306.00
    • EUR 1951.00
    • EUR 1026.00
    • EUR 1422.00
    • EUR 431.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 50.4 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Protein cereblon(CRBN) expressed in Baculovirus
    Human Protein cereblon (CRBN)
    1-CSB-CF842761HU
    • EUR 965.00
    • EUR 665.00
    • EUR 715.00
    • 1MG
    • 200ug
    • 500ug
    • MW: 54.5 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system
    Human Protein cereblon (CRBN)
    1-CSB-CF842761HUa6
    • EUR 965.00
    • EUR 665.00
    • EUR 715.00
    • 1MG
    • 200ug
    • 500ug
    • MW: 64.5 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system
    Human Protein cereblon (CRBN)
    1-CSB-CF842761HUc7
    • EUR 965.00
    • EUR 665.00
    • EUR 715.00
    • 1MG
    • 200ug
    • 500ug
    • MW: 51.2 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system
    Mouse Protein cereblon, Crbn ELISA KIT
    ELI-10495m 96 Tests
    EUR 865
    Chicken Protein cereblon, CRBN ELISA KIT
    ELI-25557c 96 Tests
    EUR 928
    Cow Protein cereblon (CRBN) ELISA Kit
    abx516195-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Chicken Protein cereblon (CRBN) ELISA Kit
    abx516196-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Rat Protein cereblon (CRBN) ELISA Kit
    abx516199-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.
    ELISA kit for Mouse CRBN (Cereblon)
    ELK7246 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
    • Show more
    Description: A sandwich ELISA kit for detection of Cereblon from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Bovine Protein cereblon, CRBN ELISA KIT
    ELI-50593b 96 Tests
    EUR 928
    Rat Protein cereblon, Crbn ELISA KIT
    ELI-47508r 96 Tests
    EUR 886
    Mouse Cereblon (CRBN) CLIA Kit
    20-abx495270
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Mouse Protein cereblon (Crbn)
    1-CSB-YP806030MO
    • EUR 504.00
    • EUR 265.00
    • EUR 1832.00
    • EUR 763.00
    • EUR 1216.00
    • EUR 334.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 54.9 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Mouse Protein cereblon(Crbn) expressed in Yeast
    Protein Cereblon (CRBN) Antibody
    20-abx003568
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Protein Cereblon (CRBN) Antibody
    abx200563-50ug 50 ug
    EUR 453
    • Shipped within 3-5 working days.
    Protein Cereblon (CRBN) Antibody
    20-abx322665
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Protein Cereblon (CRBN) Antibody
    20-abx322666
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Mouse Cereblon (CRBN) Protein
    20-abx652847
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Mouse Cereblon (CRBN) Protein
    20-abx652848
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Protein Cereblon (CRBN) Antibody
    abx231954-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    Crbn ELISA Kit| Rat Protein cereblon ELISA Kit
    EF018463 96 Tests
    EUR 689
    Crbn ELISA Kit| Mouse Protein cereblon ELISA Kit
    EF014465 96 Tests
    EUR 689
    CRBN ELISA Kit| Bovine Protein cereblon ELISA Kit
    EF011221 96 Tests
    EUR 689
    CRBN ELISA Kit| chicken Protein cereblon ELISA Kit
    EF012243 96 Tests
    EUR 689
    Rabbit Polyclonal antibody Anti-CRBN
    Anti-CRBN 50 µg
    EUR 349
    Polyclonal CRBN / Cereblon Antibody (C-Terminus)
    APR11660G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN / Cereblon (C-Terminus). This antibody is tested and proven to work in the following applications:
    Human CRBN ELISA Kit
    ELA-E12793h 96 Tests
    EUR 824
    CRBN ELISA KIT|Human
    EF005038 96 Tests
    EUR 689
    CRBN ELISA Kit (Human) (OKAN05721)
    OKAN05721 96 Wells
    EUR 792
    Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic cognitive disability. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL
    CRBN ELISA Kit (Human) (OKCD08967)
    OKCD08967 96 Wells
    EUR 975
    Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutatio;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL
    CRBN ELISA Kit (Human) (OKEH02269)
    OKEH02269 96 Wells
    EUR 662
    Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.2 ng/mL
    ELISA kit for Human Protein cereblon
    EK3125 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein cereblon in samples from serum, plasma, tissue homogenates and other biological fluids.
    CRBN ELISA Kit (Mouse) (OKCD02462)
    OKCD02462 96 Wells
    EUR 857
    Description: Description of target: Substrate recognition component of a DCX (DDB1-CUL4-X-box) E3 protein ligase complex that mediates the ubiquitination and subsequent proteasomal degradation of target proteins, such as MEIS2. Normal degradation of key regulatory proteins is required for normal limb outgrowth and expression of the fibroblast growth factor FGF8. May play a role in memory and learning by regulating the assembly and neuronal surface expression of large-conductance calcium-activated potassium channels in brain regions involved in memory and learning via its interaction with KCNT1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL
    CRBN ELISA Kit (Bovine) (OKEH07882)
    OKEH07882 96 Wells
    EUR 1092
    Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
    CRBN ELISA Kit (Chicken) (OKEH07883)
    OKEH07883 96 Wells
    EUR 1184
    Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    CRBN antibody
    70R-16578 50 ul
    EUR 435
    Description: Rabbit polyclonal CRBN antibody
    CRBN antibody
    70R-3211 50 ug
    EUR 467
    Description: Rabbit polyclonal CRBN antibody raised against the N terminal of CRBN
    CRBN Antibody
    1-CSB-PA842761ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
    CRBN Antibody
    1-CSB-PA842761ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
    CRBN Antibody
    1-CSB-PA005944GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    CRBN Antibody
    DF12054 200ul
    EUR 304
    Description: CRBN antibody detects endogenous levels of CRBN.
    CRBN siRNA
    20-abx901245
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CRBN siRNA
    20-abx912756
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CRBN siRNA
    20-abx912757
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    anti-CRBN
    YF-PA18916 50 ug
    EUR 363
    Description: Mouse polyclonal to CRBN
    Human CRBN shRNA Plasmid
    20-abx959590
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    CRBN Polyclonal Antibody
    30601-100ul 100ul
    EUR 252
    CRBN Polyclonal Antibody
    30601-50ul 50ul
    EUR 187
    CRBN Blocking Peptide
    33R-2125 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRBN antibody, catalog no. 70R-3211
    CRBN Blocking Peptide
    DF12054-BP 1mg
    EUR 195
    Polyclonal CRBN Antibody
    APR11661G 0.1 mg
    EUR 659
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN . This antibody is tested and proven to work in the following applications:
    CRBN cloning plasmid
    CSB-CL842761HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1329
    • Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgcagagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacat
    • Show more
    Description: A cloning plasmid for the CRBN gene.
    CRBN cloning plasmid
    CSB-CL842761HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1326
    • Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacatacc
    • Show more
    Description: A cloning plasmid for the CRBN gene.
    CRBN Rabbit pAb
    A4722-100ul 100 ul
    EUR 308
    CRBN Rabbit pAb
    A4722-200ul 200 ul
    EUR 459
    CRBN Rabbit pAb
    A4722-20ul 20 ul
    EUR 183
    CRBN Rabbit pAb
    A4722-50ul 50 ul
    EUR 223
    anti- CRBN antibody
    FNab01954 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:2000
    • IHC: 1:50-1:200
    • Immunogen: cereblon
    • Uniprot ID: Q96SW2
    • Gene ID: 51185
    • Research Area: Metabolism
    Description: Antibody raised against CRBN
    Anti-CRBN antibody
    PAab01954 100 ug
    EUR 355
    Anti-CRBN antibody
    STJ26824 100 µl
    EUR 277
    Description: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.
    CRBN ORF Vector (Human) (pORF)
    ORF002655 1.0 ug DNA
    EUR 95
    CRBN ORF Vector (Human) (pORF)
    ORF002656 1.0 ug DNA
    EUR 95
    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
    Column Packing Kit
    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
    PCR Mycoplasma Detection Kit
    M034-Kit Kit
    EUR 266
    Homo-PROTAC cereblon degrader 1
    HY-111594 10mg
    EUR 1772
    Rat CRBN shRNA Plasmid
    20-abx988863
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse CRBN shRNA Plasmid
    20-abx975104
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    CRBN Polyclonal Conjugated Antibody
    C30601 100ul
    EUR 397
    CRBN sgRNA CRISPR Lentivector set (Human)
    K0504901 3 x 1.0 ug
    EUR 339
    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9
    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9
    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9
    Recombinant Human Protein cereblon Protein, His, Baculovirus-100ug
    QP10056-ba-100ug 100ug
    EUR 1260
    Recombinant Human Protein cereblon Protein, His, Baculovirus-20ug
    QP10056-ba-20ug 20ug
    EUR 489
    Recombinant Human Protein cereblon Protein, His, Baculovirus-50ug
    QP10056-ba-50ug 50ug
    EUR 915
    Crbn ORF Vector (Rat) (pORF)
    ORF065411 1.0 ug DNA
    EUR 506
    Crbn ORF Vector (Mouse) (pORF)
    ORF041971 1.0 ug DNA
    EUR 506
    Crbn ORF Vector (Mouse) (pORF)
    ORF041972 1.0 ug DNA
    EUR 506
    CRBN sgRNA CRISPR Lentivector (Human) (Target 1)
    K0504902 1.0 ug DNA
    EUR 154
    CRBN sgRNA CRISPR Lentivector (Human) (Target 2)
    K0504903 1.0 ug DNA
    EUR 154
    CRBN sgRNA CRISPR Lentivector (Human) (Target 3)
    K0504904 1.0 ug DNA
    EUR 154
    CRBN Protein Vector (Human) (pPB-C-His)
    PV010617 500 ng
    EUR 329
    CRBN Protein Vector (Human) (pPB-N-His)
    PV010618 500 ng
    EUR 329
    CRBN Protein Vector (Human) (pPM-C-HA)
    PV010619 500 ng
    EUR 329
    CRBN Protein Vector (Human) (pPM-C-His)
    PV010620 500 ng
    EUR 329
    CRBN Protein Vector (Human) (pPB-C-His)
    PV010621 500 ng
    EUR 329
    CRBN Protein Vector (Human) (pPB-N-His)
    PV010622 500 ng
    EUR 329
    CRBN Protein Vector (Human) (pPM-C-HA)
    PV010623 500 ng
    EUR 329
    CRBN Protein Vector (Human) (pPM-C-His)
    PV010624 500 ng
    EUR 329