Human CRBN(Cereblon) ELISA Kit

Human CRBN(Cereblon) ELISA Kit

To Order Contact us: 

Human Cereblon (CRBN) ELISA Kit
RDR-CRBN-Hu-96Tests 96 Tests
EUR 756
Human Cereblon (CRBN) ELISA Kit
RD-CRBN-Hu-48Tests 48 Tests
EUR 521
Human Cereblon (CRBN) ELISA Kit
RD-CRBN-Hu-96Tests 96 Tests
EUR 723
Mouse Cereblon (CRBN) ELISA Kit
DLR-CRBN-Mu-48T 48T
EUR 527
  • Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids.
Mouse Cereblon (CRBN) ELISA Kit
DLR-CRBN-Mu-96T 96T
EUR 688
  • Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids.
Mouse Cereblon (CRBN) ELISA Kit
RDR-CRBN-Mu-48Tests 48 Tests
EUR 557
Mouse Cereblon (CRBN) ELISA Kit
RDR-CRBN-Mu-96Tests 96 Tests
EUR 774
Mouse Cereblon (CRBN) ELISA Kit
RD-CRBN-Mu-48Tests 48 Tests
EUR 533
Mouse Cereblon (CRBN) ELISA Kit
RD-CRBN-Mu-96Tests 96 Tests
EUR 740
Human Cereblon (CRBN)ELISA Kit
201-12-2889 96 tests
EUR 440
  • This Cereblon ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Cereblon (CRBN) ELISA Kit
20-abx151037
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Cereblon(CRBN)ELISA Kit
QY-E05053 96T
EUR 400
Human Cereblon ELISA Kit (CRBN)
RK01182 96 Tests
EUR 521
Human Cereblon (CRBN) ELISA Kit
SEG676Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.
Human Cereblon (CRBN) ELISA Kit
SEG676Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.
Human Cereblon (CRBN) ELISA Kit
SEG676Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.
Human Cereblon (CRBN) ELISA Kit
SEG676Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.
Human Cereblon (CRBN) ELISA Kit
4-SEG676Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
  • Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cereblon (CRBN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Mouse Cereblon (CRBN) ELISA Kit
20-abx153810
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Cereblon (CRBN) ELISA Kit
SEG676Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.
Mouse Cereblon (CRBN) ELISA Kit
SEG676Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.
Mouse Cereblon (CRBN) ELISA Kit
SEG676Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.
Mouse Cereblon (CRBN) ELISA Kit
SEG676Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.
Mouse Cereblon (CRBN) ELISA Kit
4-SEG676Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A
  • Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Cereblon (CRBN) in samples from Tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Cereblon (CRBN) Antibody
20-abx175781
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.
Cereblon (CRBN) Antibody
20-abx175782
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Cereblon (CRBN) Antibody
20-abx175783
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Cereblon (CRBN) Antibody
20-abx111556
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Cereblon (CRBN) Antibody
20-abx171671
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Human CRBN/ Protein cereblon ELISA Kit
E0552Hu 1 Kit
EUR 605
Human Protein cereblon (CRBN) ELISA Kit
abx250736-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human CRBN(Protein cereblon) ELISA Kit
EH1457 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q96SW2
  • Alias: CRBN/Protein cereblon/DKFZp781K0715/MGC27358/MRT2A/AD-006
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
Human Protein cereblon, CRBN ELISA KIT
ELI-10494h 96 Tests
EUR 824
ELISA kit for Human CRBN (Cereblon)
ELK4870 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
  • Show more
Description: A sandwich ELISA kit for detection of Cereblon from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Cereblon (CRBN) CLIA Kit
20-abx495269
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Human Cereblon (CRBN) Protein
20-abx652846
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Protein cereblon (CRBN)
1-CSB-BP842761HU
  • EUR 761.00
  • EUR 306.00
  • EUR 1951.00
  • EUR 1026.00
  • EUR 1422.00
  • EUR 431.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.4 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in Baculovirus
Human Protein cereblon (CRBN)
1-CSB-CF842761HU
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 54.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system
Human Protein cereblon (CRBN)
1-CSB-CF842761HUa6
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 64.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system
Human Protein cereblon (CRBN)
1-CSB-CF842761HUc7
  • EUR 965.00
  • EUR 665.00
  • EUR 715.00
  • 1MG
  • 200ug
  • 500ug
  • MW: 51.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system
Mouse Protein cereblon, Crbn ELISA KIT
ELI-10495m 96 Tests
EUR 865
Chicken Protein cereblon, CRBN ELISA KIT
ELI-25557c 96 Tests
EUR 928
Cow Protein cereblon (CRBN) ELISA Kit
abx516195-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Chicken Protein cereblon (CRBN) ELISA Kit
abx516196-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Rat Protein cereblon (CRBN) ELISA Kit
abx516199-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
ELISA kit for Mouse CRBN (Cereblon)
ELK7246 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N
  • Show more
Description: A sandwich ELISA kit for detection of Cereblon from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Bovine Protein cereblon, CRBN ELISA KIT
ELI-50593b 96 Tests
EUR 928
Rat Protein cereblon, Crbn ELISA KIT
ELI-47508r 96 Tests
EUR 886
Mouse Cereblon (CRBN) CLIA Kit
20-abx495270
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Protein cereblon (Crbn)
1-CSB-YP806030MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Protein cereblon(Crbn) expressed in Yeast
Protein Cereblon (CRBN) Antibody
20-abx003568
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Cereblon (CRBN) Antibody
abx200563-50ug 50 ug
EUR 453
  • Shipped within 3-5 working days.
Protein Cereblon (CRBN) Antibody
20-abx322665
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Protein Cereblon (CRBN) Antibody
20-abx322666
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mouse Cereblon (CRBN) Protein
20-abx652847
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Cereblon (CRBN) Protein
20-abx652848
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Protein Cereblon (CRBN) Antibody
abx231954-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Crbn ELISA Kit| Rat Protein cereblon ELISA Kit
EF018463 96 Tests
EUR 689
Crbn ELISA Kit| Mouse Protein cereblon ELISA Kit
EF014465 96 Tests
EUR 689
CRBN ELISA Kit| Bovine Protein cereblon ELISA Kit
EF011221 96 Tests
EUR 689
CRBN ELISA Kit| chicken Protein cereblon ELISA Kit
EF012243 96 Tests
EUR 689
Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
Polyclonal CRBN / Cereblon Antibody (C-Terminus)
APR11660G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN / Cereblon (C-Terminus). This antibody is tested and proven to work in the following applications:
Human CRBN ELISA Kit
ELA-E12793h 96 Tests
EUR 824
CRBN ELISA KIT|Human
EF005038 96 Tests
EUR 689
ELISA kit for Human Protein cereblon
EK3125 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein cereblon in samples from serum, plasma, tissue homogenates and other biological fluids.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
CRBN antibody
70R-16578 50 ul
EUR 435
Description: Rabbit polyclonal CRBN antibody
CRBN antibody
70R-3211 50 ug
EUR 467
Description: Rabbit polyclonal CRBN antibody raised against the N terminal of CRBN
CRBN Antibody
1-CSB-PA842761ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
CRBN Antibody
1-CSB-PA842761ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
CRBN Antibody
1-CSB-PA005944GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CRBN Antibody
DF12054 200ul
EUR 304
Description: CRBN antibody detects endogenous levels of CRBN.
CRBN siRNA
20-abx901245
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CRBN siRNA
20-abx912756
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CRBN siRNA
20-abx912757
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-CRBN
YF-PA18916 50 ug
EUR 363
Description: Mouse polyclonal to CRBN
Human CRBN shRNA Plasmid
20-abx959590
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CRBN Polyclonal Antibody
30601-100ul 100ul
EUR 252
CRBN Polyclonal Antibody
30601-50ul 50ul
EUR 187
CRBN Blocking Peptide
33R-2125 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRBN antibody, catalog no. 70R-3211
CRBN Blocking Peptide
DF12054-BP 1mg
EUR 195
Polyclonal CRBN Antibody
APR11661G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN . This antibody is tested and proven to work in the following applications:
CRBN cloning plasmid
CSB-CL842761HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1329
  • Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgcagagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacat
  • Show more
Description: A cloning plasmid for the CRBN gene.
CRBN cloning plasmid
CSB-CL842761HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1326
  • Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacatacc
  • Show more
Description: A cloning plasmid for the CRBN gene.
CRBN Rabbit pAb
A4722-100ul 100 ul
EUR 308
CRBN Rabbit pAb
A4722-200ul 200 ul
EUR 459
CRBN Rabbit pAb
A4722-20ul 20 ul
EUR 183
CRBN Rabbit pAb
A4722-50ul 50 ul
EUR 223
anti- CRBN antibody
FNab01954 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:200
  • Immunogen: cereblon
  • Uniprot ID: Q96SW2
  • Gene ID: 51185
  • Research Area: Metabolism
Description: Antibody raised against CRBN
Anti-CRBN antibody
PAab01954 100 ug
EUR 355
Anti-CRBN antibody
STJ26824 100 µl
EUR 277
Description: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.
CRBN ORF Vector (Human) (pORF)
ORF002655 1.0 ug DNA
EUR 95
CRBN ORF Vector (Human) (pORF)
ORF002656 1.0 ug DNA
EUR 95
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
Rat CRBN shRNA Plasmid
20-abx988863
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse CRBN shRNA Plasmid
20-abx975104
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CRBN Polyclonal Conjugated Antibody
C30601 100ul
EUR 397
Homo-PROTAC cereblon degrader 1
HY-111594 10mg
EUR 1772
CRBN sgRNA CRISPR Lentivector set (Human)
K0504901 3 x 1.0 ug
EUR 339
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9
Recombinant Human Protein cereblon Protein, His, Baculovirus-100ug
QP10056-ba-100ug 100ug
EUR 1260
Recombinant Human Protein cereblon Protein, His, Baculovirus-20ug
QP10056-ba-20ug 20ug
EUR 489
Recombinant Human Protein cereblon Protein, His, Baculovirus-50ug
QP10056-ba-50ug 50ug
EUR 915
Crbn ORF Vector (Rat) (pORF)
ORF065411 1.0 ug DNA
EUR 506
Crbn ORF Vector (Mouse) (pORF)
ORF041971 1.0 ug DNA
EUR 506
Crbn ORF Vector (Mouse) (pORF)
ORF041972 1.0 ug DNA
EUR 506
CRBN sgRNA CRISPR Lentivector (Human) (Target 1)
K0504902 1.0 ug DNA
EUR 154
CRBN sgRNA CRISPR Lentivector (Human) (Target 2)
K0504903 1.0 ug DNA
EUR 154
CRBN sgRNA CRISPR Lentivector (Human) (Target 3)
K0504904 1.0 ug DNA
EUR 154
CRBN Protein Vector (Human) (pPB-C-His)
PV010617 500 ng
EUR 329
CRBN Protein Vector (Human) (pPB-N-His)
PV010618 500 ng
EUR 329
CRBN Protein Vector (Human) (pPM-C-HA)
PV010619 500 ng
EUR 329
CRBN Protein Vector (Human) (pPM-C-His)
PV010620 500 ng
EUR 329
CRBN Protein Vector (Human) (pPB-C-His)
PV010621 500 ng
EUR 329
CRBN Protein Vector (Human) (pPB-N-His)
PV010622 500 ng
EUR 329
CRBN Protein Vector (Human) (pPM-C-HA)
PV010623 500 ng
EUR 329
CRBN Protein Vector (Human) (pPM-C-His)
PV010624 500 ng
EUR 329
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Recombinant Human Protein cereblon Protein, His, Invitro-E.coli-100ug
QP10011-iv-100ug 100ug
EUR 1187