Human CRBN(Cereblon) ELISA Kit

Human CRBN(Cereblon) ELISA Kit

To Order Contact us: 

Human Cereblon (CRBN) ELISA Kit
RDR-CRBN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Cereblon (CRBN) ELISA Kit
RD-CRBN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Cereblon (CRBN) ELISA Kit
RD-CRBN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Cereblon (CRBN) ELISA Kit
DLR-CRBN-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit
DLR-CRBN-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Cereblon (CRBN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cereblon (CRBN) in samples from tissue homogenates or other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit
RDR-CRBN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Cereblon (CRBN) ELISA Kit
RDR-CRBN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Cereblon (CRBN) ELISA Kit
RD-CRBN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Cereblon (CRBN) ELISA Kit
RD-CRBN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Cereblon (CRBN)ELISA Kit
201-12-2889	SunredBio	96 tests	EUR 440
This Cereblon ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Cereblon (CRBN) ELISA Kit
20-abx151037	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Cereblon(CRBN)ELISA Kit
QY-E05053	Qayee Biotechnology	96T	EUR 400

Human Cereblon ELISA Kit (CRBN)
RK01182	Abclonal	96 Tests	EUR 521

Human Cereblon (CRBN) ELISA Kit
SEG676Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit
SEG676Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit
SEG676Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit
SEG676Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cereblon (CRBN) in Tissue homogenates, cell lysates and other biological fluids.

Human Cereblon (CRBN) ELISA Kit
4-SEG676Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cereblon (CRBN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Cereblon (CRBN) ELISA Kit
20-abx153810	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Cereblon (CRBN) ELISA Kit
SEG676Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit
SEG676Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit
SEG676Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit
SEG676Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Cereblon (CRBN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Cereblon (CRBN) in Tissue homogenates and other biological fluids.

Mouse Cereblon (CRBN) ELISA Kit
4-SEG676Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Cereblon elisa. Alternative names of the recognized antigen: MRT2A Mental Retardation, Non-Syndromic, Autosomal Recessive 2A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Cereblon (CRBN) in samples from Tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Cereblon (CRBN) Antibody
20-abx175781	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Cereblon (CRBN) Antibody
20-abx175782	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Cereblon (CRBN) Antibody
20-abx175783	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Cereblon (CRBN) Antibody
20-abx111556	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Cereblon (CRBN) Antibody
20-abx171671	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Human CRBN/ Protein cereblon ELISA Kit
E0552Hu	Sunlong	1 Kit	EUR 605

Human Protein cereblon (CRBN) ELISA Kit
abx250736-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human CRBN(Protein cereblon) ELISA Kit
EH1457	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q96SW2 Alias: CRBN/Protein cereblon/DKFZp781K0715/MGC27358/MRT2A/AD-006
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Protein cereblon, CRBN ELISA KIT
ELI-10494h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human CRBN (Cereblon)
ELK4870	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N Show more
Description: A sandwich ELISA kit for detection of Cereblon from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Cereblon (CRBN) CLIA Kit
20-abx495269	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Cereblon (CRBN) Protein
20-abx652846	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Protein cereblon (CRBN)
1-CSB-BP842761HU	Cusabio	EUR 761.00 EUR 306.00 EUR 1951.00 EUR 1026.00 EUR 1422.00 EUR 431.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 50.4 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in Baculovirus

Human Protein cereblon (CRBN)
1-CSB-CF842761HU	Cusabio	EUR 965.00 EUR 665.00 EUR 715.00	1MG 200ug 500ug
MW: 54.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system

Human Protein cereblon (CRBN)
1-CSB-CF842761HUa6	Cusabio	EUR 965.00 EUR 665.00 EUR 715.00	1MG 200ug 500ug
MW: 64.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system

Human Protein cereblon (CRBN)
1-CSB-CF842761HUc7	Cusabio	EUR 965.00 EUR 665.00 EUR 715.00	1MG 200ug 500ug
MW: 51.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Protein cereblon(CRBN) expressed in in vitro E.coli expression system

Mouse Protein cereblon, Crbn ELISA KIT
ELI-10495m	Lifescience Market	96 Tests	EUR 865

Chicken Protein cereblon, CRBN ELISA KIT
ELI-25557c	Lifescience Market	96 Tests	EUR 928

Cow Protein cereblon (CRBN) ELISA Kit
abx516195-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Chicken Protein cereblon (CRBN) ELISA Kit
abx516196-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Protein cereblon (CRBN) ELISA Kit
abx516199-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Mouse CRBN (Cereblon)
ELK7246	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Cereblon (CRBN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Cereblon (CRBN). N Show more
Description: A sandwich ELISA kit for detection of Cereblon from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Bovine Protein cereblon, CRBN ELISA KIT
ELI-50593b	Lifescience Market	96 Tests	EUR 928

Rat Protein cereblon, Crbn ELISA KIT
ELI-47508r	Lifescience Market	96 Tests	EUR 886

Mouse Cereblon (CRBN) CLIA Kit
20-abx495270	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Protein cereblon (Crbn)
1-CSB-YP806030MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 54.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Protein cereblon(Crbn) expressed in Yeast

Protein Cereblon (CRBN) Antibody
20-abx003568	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Protein Cereblon (CRBN) Antibody
abx200563-50ug	Abbexa	50 ug	EUR 453
Shipped within 3-5 working days.

Protein Cereblon (CRBN) Antibody
20-abx322665	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Protein Cereblon (CRBN) Antibody
20-abx322666	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Mouse Cereblon (CRBN) Protein
20-abx652847	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Cereblon (CRBN) Protein
20-abx652848	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Protein Cereblon (CRBN) Antibody
abx231954-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Crbn ELISA Kit| Rat Protein cereblon ELISA Kit
EF018463	Lifescience Market	96 Tests	EUR 689

Crbn ELISA Kit| Mouse Protein cereblon ELISA Kit
EF014465	Lifescience Market	96 Tests	EUR 689

CRBN ELISA Kit| Bovine Protein cereblon ELISA Kit
EF011221	Lifescience Market	96 Tests	EUR 689

CRBN ELISA Kit| chicken Protein cereblon ELISA Kit
EF012243	Lifescience Market	96 Tests	EUR 689

Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN	ImmunoStep	50 µg	EUR 349

Polyclonal CRBN / Cereblon Antibody (C-Terminus)
APR11660G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN / Cereblon (C-Terminus). This antibody is tested and proven to work in the following applications:

Human CRBN ELISA Kit
ELA-E12793h	Lifescience Market	96 Tests	EUR 824

CRBN ELISA KIT|Human
EF005038	Lifescience Market	96 Tests	EUR 689

CRBN ELISA Kit (Human) (OKAN05721)
OKAN05721	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic cognitive disability. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

CRBN ELISA Kit (Human) (OKCD08967)
OKCD08967	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutatio;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

CRBN ELISA Kit (Human) (OKEH02269)
OKEH02269	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.2 ng/mL

ELISA kit for Human Protein cereblon
EK3125	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protein cereblon in samples from serum, plasma, tissue homogenates and other biological fluids.

CRBN ELISA Kit (Mouse) (OKCD02462)
OKCD02462	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Substrate recognition component of a DCX (DDB1-CUL4-X-box) E3 protein ligase complex that mediates the ubiquitination and subsequent proteasomal degradation of target proteins, such as MEIS2. Normal degradation of key regulatory proteins is required for normal limb outgrowth and expression of the fibroblast growth factor FGF8. May play a role in memory and learning by regulating the assembly and neuronal surface expression of large-conductance calcium-activated potassium channels in brain regions involved in memory and learning via its interaction with KCNT1.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

CRBN ELISA Kit (Bovine) (OKEH07882)
OKEH07882	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

CRBN ELISA Kit (Chicken) (OKEH07883)
OKEH07883	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

CRBN antibody
70R-16578	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CRBN antibody

CRBN antibody
70R-3211	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CRBN antibody raised against the N terminal of CRBN

CRBN Antibody
1-CSB-PA842761ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CRBN Antibody
1-CSB-PA842761ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

CRBN Antibody
1-CSB-PA005944GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CRBN. Recognizes CRBN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CRBN Antibody
DF12054	Affbiotech	200ul	EUR 304
Description: CRBN antibody detects endogenous levels of CRBN.

CRBN siRNA
20-abx901245	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRBN siRNA
20-abx912756	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CRBN siRNA
20-abx912757	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CRBN
YF-PA18916	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CRBN

Human CRBN shRNA Plasmid
20-abx959590	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CRBN Polyclonal Antibody
30601-100ul	SAB	100ul	EUR 252

CRBN Polyclonal Antibody
30601-50ul	SAB	50ul	EUR 187

CRBN Blocking Peptide
33R-2125	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CRBN antibody, catalog no. 70R-3211

CRBN Blocking Peptide
DF12054-BP	Affbiotech	1mg	EUR 195

Polyclonal CRBN Antibody
APR11661G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CRBN . This antibody is tested and proven to work in the following applications:

CRBN cloning plasmid
CSB-CL842761HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1329 Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgcagagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacat Show more
Description: A cloning plasmid for the CRBN gene.

CRBN cloning plasmid
CSB-CL842761HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1326 Sequence: atggccggcgaaggagatcagcaggacgctgcgcacaacatgggcaaccacctgccgctcctgcctgagagtgaggaagaagatgaaatggaagttgaagaccaggatagtaaagaagccaaaaaaccaaacatcataaattttgacaccagtctgccgacatcacatacatacc Show more
Description: A cloning plasmid for the CRBN gene.

CRBN Rabbit pAb
A4722-100ul	Abclonal	100 ul	EUR 308

CRBN Rabbit pAb
A4722-200ul	Abclonal	200 ul	EUR 459

CRBN Rabbit pAb
A4722-20ul	Abclonal	20 ul	EUR 183

CRBN Rabbit pAb
A4722-50ul	Abclonal	50 ul	EUR 223

anti- CRBN antibody
FNab01954	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IHC: 1:50-1:200 Immunogen: cereblon Uniprot ID: Q96SW2 Gene ID: 51185 Research Area: Metabolism
Description: Antibody raised against CRBN

Anti-CRBN antibody
PAab01954	Lifescience Market	100 ug	EUR 355

Anti-CRBN antibody
STJ26824	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein related to the Lon protease protein family. In rodents and other mammals this gene product is found in the cytoplasm localized with a calcium channel membrane protein, and is thought to play a role in brain development. Mutations in this gene are associated with autosomal recessive nonsyndromic mental retardation. Multiple transcript variants encoding different isoforms have been found for this gene.

CRBN ORF Vector (Human) (pORF)
ORF002655	ABM	1.0 ug DNA	EUR 95

CRBN ORF Vector (Human) (pORF)
ORF002656	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Homo-PROTAC cereblon degrader 1
HY-111594	MedChemExpress	10mg	EUR 1772

Rat CRBN shRNA Plasmid
20-abx988863	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CRBN shRNA Plasmid
20-abx975104	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CRBN Polyclonal Conjugated Antibody
C30601	SAB	100ul	EUR 397

CRBN sgRNA CRISPR Lentivector set (Human)
K0504901	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Recombinant Human Protein cereblon Protein, His, Baculovirus-100ug
QP10056-ba-100ug	EnQuireBio	100ug	EUR 1260

Recombinant Human Protein cereblon Protein, His, Baculovirus-20ug
QP10056-ba-20ug	EnQuireBio	20ug	EUR 489

Recombinant Human Protein cereblon Protein, His, Baculovirus-50ug
QP10056-ba-50ug	EnQuireBio	50ug	EUR 915

Crbn ORF Vector (Rat) (pORF)
ORF065411	ABM	1.0 ug DNA	EUR 506

Crbn ORF Vector (Mouse) (pORF)
ORF041971	ABM	1.0 ug DNA	EUR 506

Crbn ORF Vector (Mouse) (pORF)
ORF041972	ABM	1.0 ug DNA	EUR 506

CRBN sgRNA CRISPR Lentivector (Human) (Target 1)
K0504902	ABM	1.0 ug DNA	EUR 154

CRBN sgRNA CRISPR Lentivector (Human) (Target 2)
K0504903	ABM	1.0 ug DNA	EUR 154

CRBN sgRNA CRISPR Lentivector (Human) (Target 3)
K0504904	ABM	1.0 ug DNA	EUR 154

CRBN Protein Vector (Human) (pPB-C-His)
PV010617	ABM	500 ng	EUR 329

CRBN Protein Vector (Human) (pPB-N-His)
PV010618	ABM	500 ng	EUR 329

CRBN Protein Vector (Human) (pPM-C-HA)
PV010619	ABM	500 ng	EUR 329

CRBN Protein Vector (Human) (pPM-C-His)
PV010620	ABM	500 ng	EUR 329

CRBN Protein Vector (Human) (pPB-C-His)
PV010621	ABM	500 ng	EUR 329

CRBN Protein Vector (Human) (pPB-N-His)
PV010622	ABM	500 ng	EUR 329

CRBN Protein Vector (Human) (pPM-C-HA)
PV010623	ABM	500 ng	EUR 329

CRBN Protein Vector (Human) (pPM-C-His)
PV010624	ABM	500 ng	EUR 329