Human RTN4R(Reticulon 4 Receptor) ELISA Kit

Human RTN4R(Reticulon 4 Receptor) ELISA Kit

To Order Contact us: 

    Human Reticulon 4 Receptor (RTN4R) ELISA Kit

    SEF991Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

    Human Reticulon 4 Receptor (RTN4R) ELISA Kit

    SEF991Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

    Human Reticulon 4 Receptor (RTN4R) ELISA Kit

    SEF991Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 Receptor (RTN4R) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 Receptor (RTN4R) in Tissue homogenates, cell lysates and other biological fluids.

    Human Reticulon 4 Receptor (RTN4R) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Reticulon 4 Receptor elisa. Alternative names of the recognized antigen: NGR
    • NOGOR
    • Nogo-66 Receptor
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 Receptor (RTN4R) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Reticulon 4 Receptor (RTN4R) Antibody

    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Reticulon 4 Receptor (RTN4R) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Reticulon 4 Receptor (RTN4R) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Reticulon 4 Receptor (RTN4R) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Reticulon 4 Receptor (RTN4R) Antibody

    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Mouse Reticulon- 4 receptor, Rtn4r ELISA KIT

    ELI-18409m 96 Tests
    EUR 865

    Human Reticulon 4 Receptor (RTN4R) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human RTN4R (Reticulon 4 Receptor)

    ELK5164 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 Receptor (RTN4R). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Retic
    • Show more
    Description: A sandwich ELISA kit for detection of Reticulon 4 Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Reticulon-4 receptor (RTN4R)

    KTE60778-48T 48T
    EUR 332
    • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Reticulon-4 receptor (RTN4R)

    KTE60778-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Reticulon-4 receptor (RTN4R)

    KTE60778-96T 96T
    EUR 539
    • Reticulon 4 receptor is the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the a
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 receptor (RTN4R) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    RTN4R Reticulon 4 Receptor Human Recombinant Protein

    PROTQ9BZR6 Regular: 10ug
    EUR 317
    Description: RTN4R produced in Sf9 Baculovirus cells is a single,glycosylated polypeptide chain containing 429 amino acids (27-447 a.a.) andhaving a molecular mass of 46.3kDa (Molecular size on SDS-PAGE will appear atapproximately 40-57 kDa). RTN4R is expressed with a 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques.

    Recombinant Human Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

    C632-10ug 10ug
    EUR 121
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Recombinant Human Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

    C632-1mg 1mg
    EUR 2283
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Recombinant Human Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

    C632-500ug 500ug
    EUR 1613
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Recombinant Human Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

    C632-50ug 50ug
    EUR 263
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB, 150mM NaCl, pH 7.4.

    Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-Fc)

    CM16-10ug 10ug
    EUR 126
    Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

    Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-Fc)

    CM16-1mg 1mg
    EUR 1877
    Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

    Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-Fc)

    CM16-500ug 500ug
    EUR 1328
    Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

    Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-Fc)

    CM16-50ug 50ug
    EUR 232
    Description: Lyophilized from a 0.2 μm filtered solution of PBS,pH7.4.

    Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

    CM42-10ug 10ug
    EUR 126
    Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

    Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

    CM42-1mg 1mg
    EUR 1877
    Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

    Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

    CM42-500ug 500ug
    EUR 1328
    Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

    Recombinant Mouse Nogo-66 Receptor/Reticulon 4 Receptor/NgR/RTN4R (C-6His)

    CM42-50ug 50ug
    EUR 232
    Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

    Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit

    CSB-EL020576HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2 (RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Reticulon-4 receptor-like 2(RTN4RL2) ELISA kit

    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 receptor-like 2(RTN4RL2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Reticulon- 4 receptor- like 2, RTN4RL2 ELISA KIT

    ELI-30455h 96 Tests
    EUR 824

    Human Reticulon- 4 receptor- like 1, RTN4RL1 ELISA KIT

    ELI-35842h 96 Tests
    EUR 824

    Human Reticulon 4 (RTN4) ELISA Kit

    DLR-RTN4-Hu-48T 48T
    EUR 517
    • Should the Human Reticulon 4 (RTN4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Reticulon 4 (RTN4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Reticulon 4 (RTN4) ELISA Kit

    DLR-RTN4-Hu-96T 96T
    EUR 673
    • Should the Human Reticulon 4 (RTN4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Reticulon 4 (RTN4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Reticulon-4(RTN4) ELISA kit

    CSB-EL020572HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4 (RTN4) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Reticulon-4(RTN4) ELISA kit

    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Reticulon-4(RTN4) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Reticulon 4 (RTN4) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Reticulon 4 (RTN4) ELISA Kit

    abx253120-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human RTN4(Reticulon 4) ELISA Kit

    EH3732 96T
    EUR 524.1
    • Detection range: 78.125-5000 pg/ml
    • Uniprot ID: Q9NQC3
    • Alias: RTN4/Reticulon-5/RTN-x/Neuroendocrine-specific protein C homolog/Neuroendocrine-specific protein(NSP)/Foocen/Neurite outgrowth inhibitor(Nogo protein)/
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

    Human Reticulon- 4, RTN4 ELISA KIT

    ELI-52764h 96 Tests
    EUR 824

    Human Reticulon 4(RTN4)ELISA Kit

    QY-E01104 96T
    EUR 361

    Human Reticulon 4 ELISA Kit (RTN4)

    RK02217 96 Tests
    EUR 521

    Human Reticulon 4 (RTN4) ELISA Kit

    RDR-RTN4-Hu-48Tests 48 Tests
    EUR 544

    Human Reticulon 4 (RTN4) ELISA Kit

    RDR-RTN4-Hu-96Tests 96 Tests
    EUR 756

    Human Reticulon 4 (RTN4) ELISA Kit

    RD-RTN4-Hu-48Tests 48 Tests
    EUR 521

    Human Reticulon 4 (RTN4) ELISA Kit

    RD-RTN4-Hu-96Tests 96 Tests
    EUR 723

    Human Reticulon 4 (RTN4) ELISA Kit

    SEF994Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

    Human Reticulon 4 (RTN4) ELISA Kit

    SEF994Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

    Human Reticulon 4 (RTN4) ELISA Kit

    SEF994Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

    Human Reticulon 4 (RTN4) ELISA Kit

    SEF994Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulon 4 (RTN4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulon 4 (RTN4) in Tissue homogenates, cell lysates and other biological fluids.

    Human Reticulon 4 (RTN4) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Reticulon 4 elisa. Alternative names of the recognized antigen: NSP
    • ASY
    • NOGO
    • NSP-CL
    • RTN-X
    • Reticulon-5
    • Foocen
    • Neurite outgrowth inhibitor
    • Neuroendocrine-specific protein
    • Neuroendocrine-specific protein C homolog
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulon 4 (RTN4) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Recombinant human Reticulon-4 receptor-like 2

    P1411 100ug Ask for price
    • Uniprot ID: Q86UN3
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human Reticulon-4 receptor-like 2

    Rtn4r/ Rat Rtn4r ELISA Kit

    ELI-40942r 96 Tests
    EUR 886

    Recombinant human Reticulon-4

    P1398 100ug Ask for price
    • Uniprot ID: Q9NQC3
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human Reticulon-4

    Mouse Reticulon- 4 receptor- like 2, Rtn4rl2 ELISA KIT

    ELI-15500m 96 Tests
    EUR 865

    Mouse Reticulon- 4 receptor- like 1, Rtn4rl1 ELISA KIT

    ELI-52476m 96 Tests
    EUR 865

    ELISA kit for Human RTN4 (Reticulon 4)

    E-EL-H2535 1 plate of 96 wells
    EUR 534
    • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

    ELISA kit for Human RTN4 (Reticulon 4)

    ELK4140 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulon 4 (RTN4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticulon 4 (RT
    • Show more
    Description: A sandwich ELISA kit for detection of Reticulon 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Reticulon-4 (RTN4)

    KTE60779-48T 48T
    EUR 332
    • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Reticulon-4 (RTN4)

    KTE60779-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Reticulon-4 (RTN4)

    KTE60779-96T 96T
    EUR 539
    • Reticulon-4 is a protein belongs to the family of reticulon-encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Reticulon-4 (RTN4) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Mouse Reticulon 4 (RTN4) ELISA Kit

    abx051861-96tests 96 tests
    EUR 786
    • Shipped within 5-10 working days.

    Rat Reticulon 4 (RTN4) ELISA Kit

    abx255978-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Mouse Reticulon- 4, Rtn4 ELISA KIT

    ELI-20214m 96 Tests
    EUR 865

    Mouse Reticulon 4 (RTN4) ELISA Kit

    abx353194-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Rat RTN4(Reticulon 4) ELISA Kit

    ER1312 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: Q9JK11
    • Alias: RTN4
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

    Human Reticulon 4 (RTN4) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

    abx122324-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

    abx032462-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

    abx032462-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Reticulon-4 Receptor-Like 1 (RTN4RL1) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    RTN4 ELISA Kit| Rat Reticulon 4 ELISA Kit

    EF018017 96 Tests
    EUR 689

    Human Reticulon 4 (RTN4) Protein

    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    ELISA kit for Mouse RTN4 (Reticulon 4)

    E-EL-M1350 1 plate of 96 wells
    EUR 534
    • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse RTN4. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Mouse RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

    ELISA kit for Rat RTN4 (Reticulon 4)

    E-EL-R1503 1 plate of 96 wells
    EUR 534
    • Gentaur's RTN4 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4. Standards or samples are added to the micro ELISA plate wells and combined with the
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

    Reticulon 4 (RTN4) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Reticulon 4 (RTN4) Antibody

    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Reticulon 4 (RTN4) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Reticulon 4 (RTN4) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Reticulon 4 (RTN4) Antibody

    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Reticulon 4 (RTN4) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Reticulon 4 (RTN4) Antibody

    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Reticulon 4 (RTN4) Antibody

    abx002254-50ul 50 ul
    EUR 356
    • Shipped within 5-10 working days.

    Recombinant Human 4-1BB Receptor Protein

    PROTQ07011-4 20ug
    EUR 317
    Description: 4-1BB Receptor, a member of the TNF superfamily of receptors, is mainly expressed on the surface of a variety of T cells, but also found in B cells, monocytes, and various transformed cell lines. 4-1BB Receptor binds to 4-1BBL to provide a co-stimulatory signal for T lymphocytes. Signaling by 4-1BB Receptor has been implicated in the antigen-presentation process and generation of cytotoxic T cells. The human 4-1BB Receptor gene codes for a 255 amino acid type I transmembrane protein containing a 17 amino acid N-terminal signal sequence, a 169 amino acid extracellular domain, a 27 amino acid transmembrane domain and a 42 amino acid cytoplasmic domain. Recombinant human soluble 4-1BB Receptor is a 167 amino acid polypeptide (17.7 kDa), which contains the cysteine rich TNFR-like extracellular domain of 4-1BB Receptor.

    Rat Reticulon 4 (RTN4) CLIA Kit

    abx197645-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    RTN4R ELISA Kit (Human) (OKCD01887)

    OKCD01887 96 Wells
    EUR 831
    Description: Description of target: Receptor for RTN4, OMG and MAG. Signaling mediates activation of Rho and downstream reorganization of the actin cytoskeleton. Mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system. Acts in conjunction with RTN4 and LINGO1 in regulating neuronal precursor cell motility during cortical development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.123 ng/mL

    RTN4R ELISA Kit (Human) (OKCA02140)

    OKCA02140 96 Wells
    EUR 833
    Description: Description of target: Receptor for RTN4, OMG and MAG. Signaling mediates activation of Rho and downstream reorganization of the actin cytoskeleton. Mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system. Acts in conjunction with RTN4 and LINGO1 in regulating neuronal precursor cell motility during cortical development.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7 pg/mL

    CLIA kit for Rat RTN4 (Reticulon 4)

    E-CL-R0748 1 plate of 96 wells
    EUR 584
    • Gentaur's RTN4 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat RTN4 . Standards or samples are added to the micro CLIA plate wells and combined with the sp
    • Show more
    Description: A sandwich CLIA kit for quantitative measurement of Rat RTN4 (Reticulon 4) in samples from Serum, Plasma, Cell supernatant

    Human RTN3(Reticulon-3) ELISA Kit

    EH12024 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: O95197
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human Reticulon 2 (RTN2) ELISA Kit

    abx382990-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Reticulon 3 (RTN3) ELISA Kit

    abx382991-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Reticulon- 2, RTN2 ELISA KIT

    ELI-36391h 96 Tests
    EUR 824

    Human Reticulon- 3, RTN3 ELISA KIT

    ELI-41269h 96 Tests
    EUR 824

    Human Reticulon 3(RTN3)ELISA Kit

    QY-E01105 96T
    EUR 361

    Human Reticulon 2(RTN2)ELISA Kit

    QY-E01106 96T
    EUR 361

    Human Reticulon 1(RTN1)ELISA Kit

    QY-E01107 96T
    EUR 361

    Mouse RTN4R PicoKine ELISA Kit

    EK2066 96 wells
    EUR 425
    Description: For quantitative detection of mouse RTN4R in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

    Rtn4r ELISA Kit (Mouse) (OKBB01433)

    OKBB01433 96 Wells
    EUR 505
    Description: Description of target: Reticulon 4 receptor (RTN4R) also known as Nogo-66 Receptor (NgR) or Nogo receptor 1 is a protein which in humans is encoded by the RTN4R gene. It is mapped to 16; 16 A3. This gene encodes the receptor for reticulon 4, oligodendrocytemyelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <50pg/ml

    Reticulon 4 Interacting Protein 1 Protein

    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    Human RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)

    ELI-29470h 96 Tests
    EUR 824

    RTN4R antibody

    70R-20040 50 ul
    EUR 435
    Description: Rabbit polyclonal RTN4R antibody

    RTN4R Antibody

    33085-100ul 100ul
    EUR 252

    RTN4R Antibody

    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human. This antibody is Unconjugated. Tested in the following application: ELISA

    RTN4R Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

    RTN4R antibody

    70R-51087 100 ul
    EUR 244
    Description: Purified Polyclonal RTN4R antibody

    RTN4R Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against RTN4R. Recognizes RTN4R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

    RTN4R siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RTN4R siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RTN4R siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.


    PVT12203 2 ug
    EUR 391

    IL-4 Interleukin 4 Human Recombinant Protein, Yeast

    PROTP05112-4 Regular: 10ug
    EUR 317
    Description: Interleukin-4 Human Recombinant produced in yeast is a single, glycosylated polypeptide chain containing 129 amino acids.;The IL-4 is purified by proprietary chromatographic techniques.

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

    DLR-CA72-4-Hu-48T 48T
    EUR 479
    • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

    DLR-CA72-4-Hu-96T 96T
    EUR 621
    • Should the Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carbohydrate Antigen 72-4 (CA72-4) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

    RDR-CA72-4-Hu-48Tests 48 Tests
    EUR 500

    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

    RDR-CA72-4-Hu-96Tests 96 Tests
    EUR 692

    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

    RD-CA72-4-Hu-48Tests 48 Tests
    EUR 478

    Human Carbohydrate Antigen 72-4 (CA72-4) ELISA Kit

    RD-CA72-4-Hu-96Tests 96 Tests
    EUR 662

    Mouse Reticulon- 3, Rtn3 ELISA KIT

    ELI-21595m 96 Tests
    EUR 865

    Mouse Reticulon- 2, Rtn2 ELISA KIT

    ELI-38724m 96 Tests
    EUR 865

    Bovine Reticulon- 3, RTN3 ELISA KIT

    ELI-41268b 96 Tests
    EUR 928

    Human RTN4R shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    RTN4R Recombinant Protein (Human)

    RP027400 100 ug Ask for price

    RTN4IP1 Reticulon 4 Interacting Protein 1 Human Recombinant Protein

    PROTQ8WWV3 Regular: 20ug
    EUR 317
    Description: RTN4IP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 379 amino acids (41-396 a.a.) and having a molecular mass of 41.4kDa. ;RTN4IP1 is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

    Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody

    abx122325-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Reticulon-4-Interacting Protein 1, Mitochondrial (RTN4IP1) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Human FibrOut 4, for brain, neural

    4-21552 1 ml Ask for price

    Human FibrOut 4, for brain, neural

    4-21553 5 x 1 ml Ask for price

    Recombinant Human PF-4 (CXCL4) Protein

    PROTP02776-4 20ug
    EUR 317
    Description: PF-4 is a CXC chemokine that is expressed in megakaryocytes and stored in the α-granules of platelets. PF-4 is chemotactic towards neutrophils and monocytes and has been shown to inhibit angiogenesis. Recombinant human PF-4 is a 7.8 kDa protein containing 70 amino acid residues, including the four highly conserved residues present in CXC chemokines.

    RTN4R Blocking Peptide

    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    RTN4R Conjugated Antibody

    C33085 100ul
    EUR 397

    RTN4R cloning plasmid

    CSB-CL880152HU-10ug 10ug
    EUR 507
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1422
    • Sequence: atgaagagggcgtccgctggagggagccggctgctggcatgggtgctgtggctgcaggcctggcaggtggcagccccatgcccaggtgcctgcgtatgctacaatgagcccaaggtgacgacaagctgcccccagcagggcctgcaggctgtgcccgtgggcatccctgctgcca
    • Show more
    Description: A cloning plasmid for the RTN4R gene.

    RTN4R Rabbit pAb

    A5847-100ul 100 ul
    EUR 308

    RTN4R Rabbit pAb

    A5847-200ul 200 ul
    EUR 459

    RTN4R Rabbit pAb

    A5847-20ul 20 ul
    EUR 183

    RTN4R Rabbit pAb

    A5847-50ul 50 ul
    EUR 223

    RTN4R Polyclonal Antibody

    ABP60283-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350
    • Applications tips:
    Description: A polyclonal antibody for detection of RTN4R from Human. This RTN4R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350

    RTN4R Polyclonal Antibody

    ABP60283-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350
    • Applications tips:
    Description: A polyclonal antibody for detection of RTN4R from Human. This RTN4R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350

    RTN4R Polyclonal Antibody

    ABP60283-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350
    • Applications tips:
    Description: A polyclonal antibody for detection of RTN4R from Human. This RTN4R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RTN4R protein at amino acid sequence of 270-350

    RTN4R Polyclonal Antibody

    ES11347-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against RTN4R from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    RTN4R Polyclonal Antibody

    ES11347-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against RTN4R from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Anti-RTN4R antibody

    STJ28410 100 µl
    EUR 277
    Description: This gene encodes the receptor for reticulon 4, oligodendrocyte myelin glycoprotein and myelin-associated glycoprotein. This receptor mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult central nervous system.

    Anti-RTN4R antibody

    STJ192505 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to RTN4R

    Rat RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)

    ELI-20212r 96 Tests
    EUR 886

    Mouse RTN1 (Reticulon- 1) ELISA Kit (CUSTOM)

    ELI-53344m 96 Tests
    EUR 865

    Human CC Chemokine receptor 4,CCR-4 ELISA Kit

    201-12-0226 96 tests
    EUR 440
    • This CC Chemokine receptor 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human CC Chemokine receptor 4(CCR-4)ELISA Kit

    GA-E0242HM-48T 48T
    EUR 289

    Human CC Chemokine receptor 4(CCR-4)ELISA Kit

    GA-E0242HM-96T 96T
    EUR 466

    Human CC Chemokine receptor 4(CCR-4)ELISA Kit

    QY-E05070 96T
    EUR 374

    RTN4R ORF Vector (Human) (pORF)

    ORF009134 1.0 ug DNA
    EUR 95

    Reticulon 1A antibody

    10R-8103 100 ug
    EUR 467
    Description: Mouse monoclonal Reticulon 1A antibody

    Reticulon 1A antibody

    10R-8104 100 ug
    EUR 467
    Description: Mouse monoclonal Reticulon 1A antibody

    Reticulon 1A antibody

    10R-8105 100 ug
    EUR 467
    Description: Mouse monoclonal Reticulon 1A antibody

    Reticulon 1C antibody

    10R-8108 100 ug
    EUR 435
    Description: Mouse monoclonal Reticulon 1C antibody

    anti-Reticulon 2

    YF-PA14468 50 ul
    EUR 363
    Description: Mouse polyclonal to Reticulon 2

    anti-Reticulon 2

    YF-PA14469 50 ug
    EUR 363
    Description: Mouse polyclonal to Reticulon 2

    anti-Reticulon 2

    YF-PA14470 100 ug
    EUR 403
    Description: Rabbit polyclonal to Reticulon 2

    anti-Reticulon 2

    YF-PA24640 50 ul
    EUR 334
    Description: Mouse polyclonal to Reticulon 2

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    DLR-IL4R-Hu-48T 48T
    EUR 463
    • Should the Human Interleukin 4 Receptor (IL4R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 4 Receptor (IL4R) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    DLR-IL4R-Hu-96T 96T
    EUR 599
    • Should the Human Interleukin 4 Receptor (IL4R) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Interleukin 4 Receptor (IL4R) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human CC Chemokine Receptor 4 ELISA kit

    E01C0912-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human CC Chemokine Receptor 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human CC Chemokine Receptor 4 ELISA kit

    E01C0912-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human CC Chemokine Receptor 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human CC Chemokine Receptor 4 ELISA kit

    E01C0912-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human CC Chemokine Receptor 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Melanocortin receptor 4(MC4R) ELISA kit

    E01M0386-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Melanocortin receptor 4(MC4R) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Melanocortin receptor 4(MC4R) ELISA kit

    E01M0386-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Melanocortin receptor 4(MC4R) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Melanocortin receptor 4(MC4R) ELISA kit

    E01M0386-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Melanocortin receptor 4(MC4R) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Glutamate receptor 4(GRIA4) ELISA kit

    E01G0393-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor 4(GRIA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Glutamate receptor 4(GRIA4) ELISA kit

    E01G0393-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor 4(GRIA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Glutamate receptor 4(GRIA4) ELISA kit

    E01G0393-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Glutamate receptor 4(GRIA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Protease Activated Receptor 4 ELISA kit

    E01P0180-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protease Activated Receptor 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Protease Activated Receptor 4 ELISA kit

    E01P0180-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protease Activated Receptor 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Protease Activated Receptor 4 ELISA kit

    E01P0180-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protease Activated Receptor 4 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Melanocortin receptor 4 (MC4R) ELISA Kit

    abx250638-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    ELISA kit for Human Melanocortin receptor 4

    EK2930 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Melanocortin receptor 4 in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human MC4R/ Melanocortin receptor 4 ELISA Kit

    E1563Hu 1 Kit
    EUR 605

    Human MC4R(Melanocortin receptor 4) ELISA Kit

    EH1367 96T
    EUR 567.6
    • Detection range: 0.312-20 ng/ml
    • Uniprot ID: P32245
    • Alias: MC4R(Melanocortin receptor 4)/MC4-R
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human IL4R(Interleukin-4 receptor) ELISA Kit

    EH2060 96T
    EUR 567.6
    • Detection range: 15.6-1000 pg/ml
    • Uniprot ID: P24394
    • Alias: IL4R(Interleukin-4 receptor subunit alpha)/IL-4 receptor subunit alpha/IL-4R subunit alpha/IL-4R-alpha/IL-4RA/IL4RA/interleukin 4 receptor/interleukin-4 receptor alpha chain
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

    Human Melanocortin receptor 4, MC4R ELISA KIT

    ELI-13977h 96 Tests
    EUR 824

    Human Glutamate receptor 4, GRIA4 ELISA KIT

    ELI-31354h 96 Tests
    EUR 824

    Human Somatostatin Receptor 4 (SSTR4) ELISA Kit

    abx352062-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    abx574446-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Somatostatin Receptor 4(SSTR4)ELISA Kit

    QY-E01572 96T
    EUR 361

    Human Melanocortin 4 Receptor(MC4R)ELISA Kit

    QY-E03126 96T
    EUR 361

    Human Testicular Receptor 4(TR4)ELISA Kit

    QY-E03350 96T
    EUR 361

    Human Galanin Receptor 4(GALR4)ELISA Kit

    QY-E03424 96T
    EUR 361

    Human Complement Receptor 4(CR4)ELISA Kit

    QY-E04082 96T
    EUR 394

    Human Interleukin 4 Receptor ELISA Kit (IL4R)

    RK01679 96 Tests
    EUR 521

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    SEC031Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 4 Receptor (IL4R) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 4 Receptor (IL4R) in serum, plasma, tissue homogenates and other biological fluids.

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    SEC031Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 4 Receptor (IL4R) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 4 Receptor (IL4R) in serum, plasma, tissue homogenates and other biological fluids.

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    SEC031Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 4 Receptor (IL4R) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 4 Receptor (IL4R) in serum, plasma, tissue homogenates and other biological fluids.

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    SEC031Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Interleukin 4 Receptor (IL4R) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Interleukin 4 Receptor (IL4R) in serum, plasma, tissue homogenates and other biological fluids.

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Interleukin 4 Receptor elisa. Alternative names of the recognized antigen: CD124
    • IL4-R
    • IL4RA
    • IL4-BP
    • Soluble interleukin-4 receptor subunit alpha
    • IL-4-binding protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Interleukin 4 Receptor (IL4R) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    RDR-IL4R-Hu-48Tests 48 Tests
    EUR 481

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    RDR-IL4R-Hu-96Tests 96 Tests
    EUR 665

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    RD-IL4R-Hu-48Tests 48 Tests
    EUR 460

    Human Interleukin 4 Receptor (IL4R) ELISA Kit

    RD-IL4R-Hu-96Tests 96 Tests
    EUR 636