Human PCDH20(Protocadherin 20) ELISA Kit

Human PCDH20(Protocadherin 20) ELISA Kit

To Order Contact us: 

Human Protocadherin 20 (PCDH20) ELISA Kit
SEE100Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.

Human Protocadherin 20 (PCDH20) ELISA Kit
SEE100Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.

Human Protocadherin 20 (PCDH20) ELISA Kit
SEE100Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.

Human Protocadherin 20 (PCDH20) ELISA Kit
SEE100Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.

Human Protocadherin 20 (PCDH20) ELISA Kit
4-SEE100Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Protocadherin 20 elisa. Alternative names of the recognized antigen: PCDH13 Protocadherin-13
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin 20 (PCDH20) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Protocadherin 20 (PCDH20) Antibody
abx026367-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody
abx026367-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody
20-abx126333	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody
20-abx128339	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Protocadherin 20 (PCDH20) Antibody
abx122071-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody
20-abx174302	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Protocadherin 20 (PCDH20) Antibody
20-abx308999	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Recombinant Protocadherin 20 (PCDH20)
4-RPE100Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8N6Y1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Protocadherin 20 expressed in: E.coli

Mouse Protocadherin- 20, Pcdh20 ELISA KIT
ELI-45080m	Lifescience Market	96 Tests	EUR 865

Human Protocadherin 20 (PCDH20) Protein
20-abx166617	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Protocadherin 20 (PCDH20) CLIA Kit
20-abx494497	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human PCDH20 (Protocadherin 20)
ELK5031	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protocadherin 20 (PCDH20). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protocad Show more
Description: A sandwich ELISA kit for detection of Protocadherin 20 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Protocadherin-20 (PCDH20)
KTE61298-48T	Abbkine	48T	EUR 332
Protocadherin-20 is a protein belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-20 (PCDH20) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protocadherin-20 (PCDH20)
KTE61298-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Protocadherin-20 is a protein belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-20 (PCDH20) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protocadherin-20 (PCDH20)
KTE61298-96T	Abbkine	96T	EUR 539
Protocadherin-20 is a protein belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from Show more
Description: Quantitative sandwich ELISA for measuring Human Protocadherin-20 (PCDH20) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Protocadherin 20 (PCDH20) Antibody (HRP)
20-abx309000	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody (FITC)
20-abx309001	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Antibody (Biotin)
20-abx309002	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human)
4-PAE100Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCDH20 (Arg64~Phe209) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20)

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), APC
4-PAE100Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCDH20 (Arg64~Phe209) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with APC.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), Biotinylated
4-PAE100Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCDH20 (Arg64~Phe209) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with Biotin.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), Cy3
4-PAE100Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCDH20 (Arg64~Phe209) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with Cy3.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), FITC
4-PAE100Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCDH20 (Arg64~Phe209) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with FITC.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), HRP
4-PAE100Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCDH20 (Arg64~Phe209) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with HRP.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), PE
4-PAE100Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCDH20 (Arg64~Phe209) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with PE.

Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), APC-Cy7
4-PAE100Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PCDH20 (Arg64~Phe209) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with APC-Cy7.

FGF-20, human recombinant
4589-20	Biovision		EUR 277

99445-20 DCT 20 X 150MM
99445-20	CORNING	250/pk	EUR 119
Description: Disposable Culture Tubes; DCT's, CGW

20(S)-NotoginsenosideR2
N2028-20	ApexBio	20 mg	EUR 630
Description: Extracted from Pseudo-ginseng;Store the product in sealed, cool and dry condition

PCDH20 Antibody
1-CSB-PA822719LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCDH20. Recognizes PCDH20 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

PCDH20 siRNA
20-abx927872	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PCDH20 siRNA
20-abx927873	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-PCDH20
YF-PA26579	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to PCDH20

20(R)Ginsenoside?Rh1
N2192-20	ApexBio	20 mg	EUR 514
Description: Extracted from Panax ginseng C. A. Mey. dried roots;Store the product in sealed, cool and dry condition

20(R)Ginsenoside Rg2
N2195-20	ApexBio	20 mg	EUR 224
Description: Extracted from Panax ginseng C. A. Mey. dried roots;Store the product in sealed, cool and dry condition

20(R)Ginsenoside Rg3
N2198-20	ApexBio	20 mg	EUR 514
Description: Extracted from Panax ginseng C.A.Mey. roots;Store the product in sealed, cool and dry condition

Human Protocadherin 1 ELISA kit
E01P0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protocadherin 1 ELISA kit
E01P0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protocadherin 1 ELISA kit
E01P0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

DiagNano Gold Nanoparticle Passive Conjugation Kit, 20 nm
GPK-20	Creative Diagnostics	1 kit	EUR 715

Human PCDH20 shRNA Plasmid
20-abx962130	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human cytokeratin 20,CK-20 ELISA Kit
201-12-1719	SunredBio	96 tests	EUR 440
This cytokeratin 20 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 20,IL-20 ELISA KIT
201-12-2164	SunredBio	96 tests	EUR 440
This Interleukin 20 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human IL-20(Interleukin 20) ELISA Kit
EH0190	FN Test	96T	EUR 524.1
Detection range: 62.5-4000 pg/ml Uniprot ID: Q9NYY1 Alias: IL-20/IL20/ZCYTO10/IL10D
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml

Human Interleukin 20(IL-20)ELISA Kit
CSB-E15015h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 20 (IL-20) in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 20(IL-20)ELISA Kit
1-CSB-E15015h	Cusabio	EUR 678.00 EUR 4644.00 EUR 2467.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 20(IL-20) in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human cytokeratin 20,CK-20 ELISA Kit
CN-04600H1	ChemNorm	96T	EUR 464

Human cytokeratin 20,CK-20 ELISA Kit
CN-04600H2	ChemNorm	48T	EUR 313

Human cytokeratin 20(CK-20)ELISA Kit
GA-E1735HM-48T	GenAsia Biotech	48T	EUR 289

Human cytokeratin 20(CK-20)ELISA Kit
GA-E1735HM-96T	GenAsia Biotech	96T	EUR 466

Human cytokeratin 20(CK-20)ELISA Kit
QY-E00973	Qayee Biotechnology	96T	EUR 361

Human Interleukin 20(IL-20)ELISA Kit
QY-E04295	Qayee Biotechnology	96T	EUR 361

ExoDNAPS? Circulating and Exosome-associated DNA Extraction Kit (Human Plasma/Serum, 20 reactions)
K1230-20	Biovision		EUR 718

20UL FILTER TIPS FOR P-20
TF-20	CORNING	1000/pk	EUR 418
Description: Filter Tip; Filter Tips Pipette - Axygen

Human protocadherin 1,PCDH1 ELISA Kit
201-12-0235	SunredBio	96 tests	EUR 440
This protocadherin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit
DLR-PCDH15-Hu-48T	DL Develop	48T	EUR 517
Should the Human Protocadherin 15 (PCDH15) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin 15 (PCDH15) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit
DLR-PCDH15-Hu-96T	DL Develop	96T	EUR 673
Should the Human Protocadherin 15 (PCDH15) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin 15 (PCDH15) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Protocadherin-10(PCDH10) ELISA kit
CSB-EL017525HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-10 (PCDH10) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protocadherin-10(PCDH10) ELISA kit
1-CSB-EL017525HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-10(PCDH10) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Protocadherin β 2 ELISA kit
E01P0065-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protocadherin β 2 ELISA kit
E01P0065-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protocadherin β 2 ELISA kit
E01P0065-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protocadherin 15 (PCDH15) ELISA Kit
20-abx152866	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Protocadherin 1 (PCDH1) ELISA Kit
abx251163-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Protocadherin 15 (PCDH15) ELISA Kit
abx252905-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human PCDH15(Protocadherin 15) ELISA Kit
EH3515	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q96QU1 Alias: PCDH15/CDHR15/DFNB23/PCDH15/USH1F/autosomal recessive 23/cadherin-related family member 15/DKFZp667A1711/protocadherin-15/protocadherin-related 15
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

ELISA kit for Human Protocadherin-1
EK3817	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protocadherin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human PCDH1/ Protocadherin-1 ELISA Kit
E1870Hu	Sunlong	1 Kit	EUR 571

Human PCDH1(Protocadherin-1) ELISA Kit
EH1850	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q08174 Alias: PCDH1/Protocadherin-1/Cadherin-like protein 1/Protocadherin-42/PC42/PCDH42/protocadherin 42/Protocadherin-42/cadherin-like 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Protocadherin- 23, DCHS2 ELISA KIT
ELI-14603h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin- 17, PCDH17 ELISA KIT
ELI-12385h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin- 18, PCDH18 ELISA KIT
ELI-21159h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin- 12, PCDH12 ELISA KIT
ELI-21514h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin- 7, PCDH7 ELISA KIT
ELI-22678h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin- 1, PCDH1 ELISA KIT
ELI-05280h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin- 16, DCHS1 ELISA KIT
ELI-43183h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin- 10, PCDH10 ELISA KIT
ELI-45884h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin- 19, PCDH19 ELISA KIT
ELI-45885h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin-23(DCHS2) ELISA kit
CSB-EL006545HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-23 (DCHS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Protocadherin-23(DCHS2) ELISA kit
1-CSB-EL006545HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-23(DCHS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human protocadherin 1,PCDH1 ELISA Kit
CN-04176H1	ChemNorm	96T	EUR 455

Human protocadherin 1,PCDH1 ELISA Kit
CN-04176H2	ChemNorm	48T	EUR 304

Human Protocadherin 9 (PCDH9) ELISA Kit
abx382086-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protocadherin-1 (PCDH1) ELISA Kit
abx517940-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human protocadherin 1(PCDH1)ELISA Kit
GA-E0251HM-48T	GenAsia Biotech	48T	EUR 289

Human protocadherin 1(PCDH1)ELISA Kit
GA-E0251HM-96T	GenAsia Biotech	96T	EUR 466

Human Protocadherin- 8, PCDH8 ELISA KIT
ELI-35669h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin- 15, PCDH15 ELISA KIT
ELI-37484h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin- 9, PCDH9 ELISA KIT
ELI-37492h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin 9(PCDH9)ELISA Kit
QY-E00380	Qayee Biotechnology	96T	EUR 361

Human Protocadherin 8(PCDH8)ELISA Kit
QY-E00381	Qayee Biotechnology	96T	EUR 361

Human Protocadherin 7(PCDH7)ELISA Kit
QY-E00382	Qayee Biotechnology	96T	EUR 394

Human Protocadherin 21(PCDH21)ELISA Kit
QY-E00383	Qayee Biotechnology	96T	EUR 394

Human Protocadherin 19(PCDH19)ELISA Kit
QY-E00385	Qayee Biotechnology	96T	EUR 394

Human Protocadherin 18(PCDH18)ELISA Kit
QY-E00386	Qayee Biotechnology	96T	EUR 394

Human Protocadherin 17(PCDH17)ELISA Kit
QY-E00387	Qayee Biotechnology	96T	EUR 394

Human Protocadherin 12(PCDH12)ELISA Kit
QY-E00388	Qayee Biotechnology	96T	EUR 394

Human Protocadherin 11(PCDH11)ELISA Kit
QY-E00389	Qayee Biotechnology	96T	EUR 394

Human Protocadherin 10(PCDH10)ELISA Kit
QY-E00390	Qayee Biotechnology	96T	EUR 361

Human protocadherin 1(PCDH1)ELISA Kit
QY-E00391	Qayee Biotechnology	96T	EUR 361

Human Protocadherin 15 (PCDH15) ELISA Kit
SEE095Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit
SEE095Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit
SEE095Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit
SEE095Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.

Human Protocadherin 15 (PCDH15) ELISA Kit
4-SEE095Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Protocadherin 15 elisa. Alternative names of the recognized antigen: USH1F DFNB23 CDHR15 Deafness, Autosomal Recessive 23 Cadherin-Related Family Member 15
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin 15 (PCDH15) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Protocadherin 15 (PCDH15) ELISA Kit
RDR-PCDH15-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Protocadherin 15 (PCDH15) ELISA Kit
RDR-PCDH15-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Protocadherin 15 (PCDH15) ELISA Kit
RD-PCDH15-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Protocadherin 15 (PCDH15) ELISA Kit
RD-PCDH15-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

PCDH20 Polyclonal Antibody
27434-100ul	SAB	100ul	EUR 252

PCDH20 Polyclonal Antibody
27434-50ul	SAB	50ul	EUR 187

PCDH20 Rabbit pAb
A10428-100ul	Abclonal	100 ul	EUR 308

PCDH20 Rabbit pAb
A10428-200ul	Abclonal	200 ul	EUR 459

PCDH20 Rabbit pAb
A10428-20ul	Abclonal	20 ul	EUR 183

PCDH20 Rabbit pAb
A10428-50ul	Abclonal	50 ul	EUR 223

PCDH20 cloning plasmid
CSB-CL822719HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2775 Sequence: atggggcgtctacatcgtcccaggagcagcaccagctacaggaacctgccgcatctgtttctgtttttcctcttcgtgggacccttcagctgcctcgggagttacagccgggccaccgagcttctgtacagcctaaacgagggactacccgcgggggtgctcatcggcagcctgg Show more
Description: A cloning plasmid for the PCDH20 gene.

PCDH20 Polyclonal Antibody
A66378	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Anti-PCDH20 antibody
STJ112460	St John's Laboratory	100 µl	EUR 277
Description: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain.

Anti-PCDH20 (2C3)
YF-MA19261	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PCDH20

Anti-PCDH20 (1B7)
YF-MA19262	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to PCDH20

ELISA kit for Human IL-20 (Interleukin 20)
E-EL-H0279	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IL-20 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-20. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-20 (Interleukin 20) in samples from Serum, Plasma, Cell supernatant

Human CK-20/KRT20(Cytokeratin 20) ELISA Kit
EH2822	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P35900 Alias: CK-20/KRT20/Protein IT/Cytokeratin-20(CK-20)/Keratin-20(K20)/Keratin, type I cytoskeletal 20
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Matrix Metalloproteinase 20(MMP-20)ELISA Kit
QY-E02992	Qayee Biotechnology	96T	EUR 361

AXYGEN® GEL TRAY 20 X 20 CM FOR USE WITH 20 CM GEL BOX, UV TRANSPARENT
HGB20-20-GT	CORNING	1/pk	EUR 97
Description: Lab Equipment; Axygen Branded EQ

TumorExoRNA? Tumor-derived exosome immunocapture and RNA extraction kit (20 reactions)
K1221-20	Biovision		EUR 1219

DiagNano Silica-Coated Gold Nanoparticles, 20 nm
CG-20	Creative Diagnostics	10mL	EUR 719

AXYGEN® HORIZONTAL GEL BOX, 20 CM
HGB-20	CORNING	1/pk	EUR 541
Description: Lab Equipment; Axygen Branded EQ

PCDH20 ORF Vector (Human) (pORF)
ORF007560	ABM	1.0 ug DNA	EUR 95

Rat Protocadherin 1 ELISA kit
E02P0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protocadherin 1 ELISA kit
E02P0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Protocadherin 1 ELISA kit
E02P0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protocadherin 1 ELISA kit
E04P0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protocadherin 1 ELISA kit
E04P0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Protocadherin 1 ELISA kit
E04P0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protocadherin 1 ELISA kit
E03P0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protocadherin 1 ELISA kit
E03P0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protocadherin 1 ELISA kit
E03P0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protocadherin 1 ELISA kit
E08P0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protocadherin 1 ELISA kit
E08P0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Protocadherin 1 ELISA kit
E08P0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protocadherin 1 ELISA kit
E06P0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protocadherin 1 ELISA kit
E06P0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Protocadherin 1 ELISA kit
E06P0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protocadherin 1 ELISA kit
E07P0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protocadherin 1 ELISA kit
E07P0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Protocadherin 1 ELISA kit
E07P0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protocadherin 1 ELISA kit
E09P0064-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protocadherin 1 ELISA kit
E09P0064-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Protocadherin 1 ELISA kit
E09P0064-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CytoKeratin 20 ELISA kit
E01C0764-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CytoKeratin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CytoKeratin 20 ELISA kit
E01C0764-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CytoKeratin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CytoKeratin 20 ELISA kit
E01C0764-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CytoKeratin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 20 ELISA kit
E01I0013-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 20 ELISA kit
E01I0013-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Interleukin 20 ELISA kit
E01I0013-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Interleukin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CK 20 ELISA Kit
EHC0771	Abclonal	96Tests	EUR 521

Human HSP-20 ELISA Kit
EHH0292	Abclonal	96Tests	EUR 521

IL-20 ELISA KIT|Human
EF000154	Lifescience Market	96 Tests	EUR 689

Human Keratin 20 ELISA Kit
ELA-E9127h	Lifescience Market	96 Tests	EUR 824

Cadherin-20 ELISA KIT|Human
EF008335	Lifescience Market	96 Tests	EUR 689

Human IL-20 ELISA Kit
LF-EK50865	Abfrontier	1×96T	EUR 648

Human IL-20 ELISA Kit
RK00180	Abclonal	96 Tests	EUR 521

IL-20 ELISA Kit| Rat Interleukin 20 ELISA Kit
EF018189	Lifescience Market	96 Tests	EUR 689

99447 DSSCT 20 X 125 W/ MARKING SPOT
99447-20	CORNING	250/pk	EUR 211
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

DiagNano Silica-Coated PEGylated Gold Nanoparticles, 20 nm
PG-20	Creative Diagnostics	10mL	EUR 719

ELISA kit for Human PCDH15 (Protocadherin 15)
E-EL-H0963	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PCDH15 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PCDH15. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PCDH15 (Protocadherin 15) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human PCDH1 (Protocadherin 1)
E-EL-H2264	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's PCDH1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PCDH1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human PCDH1 (Protocadherin 1) in samples from Serum, Plasma, Cell supernatant

Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
DLR-PCDHb16-Hu-48T	DL Develop	48T	EUR 517
Should the Human Protocadherin Beta 16 (PCDHb16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin Beta 16 (PCDHb16) in samples from tissue homogenates or other biological fluids.

Human Protocadherin Beta 16 (PCDHb16) ELISA Kit
DLR-PCDHb16-Hu-96T	DL Develop	96T	EUR 673
Should the Human Protocadherin Beta 16 (PCDHb16) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin Beta 16 (PCDHb16) in samples from tissue homogenates or other biological fluids.

Human Protocadherin Gamma A2 (PCDHgA2) ELISA Kit
DLR-PCDHgA2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Protocadherin Gamma A2 (PCDHgA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin Gamma A2 (PCDHgA2) in samples from tissue homogenates or other biological fluids.

Human Protocadherin Gamma A2 (PCDHgA2) ELISA Kit
DLR-PCDHgA2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Protocadherin Gamma A2 (PCDHgA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin Gamma A2 (PCDHgA2) in samples from tissue homogenates or other biological fluids.

Human Protocadherin Beta 15 (PCDHB15) ELISA Kit
20-abx156781	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Protocadherin gamma A2 (PCDHgA2) ELISA Kit
20-abx152654	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Protocadherin beta 16 (PCDHb16) ELISA Kit
20-abx152867	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Protocadherin Beta 16 (PCDHB16) ELISA Kit
abx252906-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Protocadherin Gamma A2 (PCDHGA2) ELISA Kit
abx252908-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human PCDHβ16(Protocadherin Beta 16) ELISA Kit
EH3516	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q9NRJ7 Alias: PCDHβ16
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human PCDHγA2(Protocadherin Gamma A2) ELISA Kit
EH3518	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q9Y5H1 Alias: PCDHγA2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human PCDHA1/ Protocadherin alpha-1 ELISA Kit
E1871Hu	Sunlong	1 Kit	EUR 571

Human Protocadherin alpha- 10, PCDHA10 ELISA KIT
ELI-14581h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin beta- 15, PCDHB15 ELISA KIT
ELI-14582h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin gamma- B3, PCDHGB3 ELISA KIT
ELI-14583h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin gamma- C3, PCDHGC3 ELISA KIT
ELI-14584h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin beta- 4, PCDHB4 ELISA KIT
ELI-14604h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin beta- 5, PCDHB5 ELISA KIT
ELI-14605h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin beta- 9, PCDHB9 ELISA KIT
ELI-14606h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin beta- 14, PCDHB14 ELISA KIT
ELI-14607h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin beta- 16, PCDHB16 ELISA KIT
ELI-14608h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin gamma- B5, PCDHGB5 ELISA KIT
ELI-14609h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin gamma- A2, PCDHGA2 ELISA KIT
ELI-16099h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin Fat 2, FAT2 ELISA KIT
ELI-09784h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin Fat 3, FAT3 ELISA KIT
ELI-09785h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin beta- 10, PCDHB10 ELISA KIT
ELI-12387h	Lifescience Market	96 Tests	EUR 824

Human Protocadherin gamma- A7, PCDHGA7 ELISA KIT
ELI-12388h	Lifescience Market	96 Tests	EUR 824