Human PCDH20(Protocadherin 20) ELISA Kit

Human PCDH20(Protocadherin 20) ELISA Kit

To Order Contact us: 

    Human Protocadherin 20 (PCDH20) ELISA Kit
    SEE100Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.
    Human Protocadherin 20 (PCDH20) ELISA Kit
    SEE100Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.
    Human Protocadherin 20 (PCDH20) ELISA Kit
    SEE100Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.
    Human Protocadherin 20 (PCDH20) ELISA Kit
    SEE100Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 20 (PCDH20) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 20 (PCDH20) in serum, plasma, tissue homogenates and other biological fluids.
    Human Protocadherin 20 (PCDH20) ELISA Kit
    4-SEE100Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Protocadherin 20 elisa. Alternative names of the recognized antigen: PCDH13
    • Protocadherin-13
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin 20 (PCDH20) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Protocadherin 20 (PCDH20) Antibody
    20-abx126333
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Protocadherin 20 (PCDH20) Antibody
    20-abx128339
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Protocadherin 20 (PCDH20) Antibody
    abx122071-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Protocadherin 20 (PCDH20) Antibody
    abx026367-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Protocadherin 20 (PCDH20) Antibody
    abx026367-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Protocadherin 20 (PCDH20) Antibody
    20-abx174302
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Protocadherin 20 (PCDH20) Antibody
    20-abx308999
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Recombinant Protocadherin 20 (PCDH20)
    4-RPE100Hu01
    • EUR 467.36
    • EUR 228.00
    • EUR 1477.60
    • EUR 559.20
    • EUR 1018.40
    • EUR 376.00
    • EUR 3544.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q8N6Y1
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 19.4kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Protocadherin 20 expressed in: E.coli
    Mouse Protocadherin- 20, Pcdh20 ELISA KIT
    ELI-45080m 96 Tests
    EUR 865
    Human Protocadherin 20 (PCDH20) Protein
    20-abx166617
    • EUR 648.00
    • EUR 272.00
    • EUR 1998.00
    • EUR 773.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Human Protocadherin 20 (PCDH20) CLIA Kit
    20-abx494497
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human PCDH20 (Protocadherin 20)
    ELK5031 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protocadherin 20 (PCDH20). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protocad
    • Show more
    Description: A sandwich ELISA kit for detection of Protocadherin 20 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Protocadherin-20 (PCDH20)
    KTE61298-48T 48T
    EUR 332
    • Protocadherin-20 is a protein belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protocadherin-20 (PCDH20) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Protocadherin-20 (PCDH20)
    KTE61298-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Protocadherin-20 is a protein belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protocadherin-20 (PCDH20) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Protocadherin-20 (PCDH20)
    KTE61298-96T 96T
    EUR 539
    • Protocadherin-20 is a protein belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protocadherin-20 (PCDH20) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Protocadherin 20 (PCDH20) Antibody (HRP)
    20-abx309000
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Protocadherin 20 (PCDH20) Antibody (FITC)
    20-abx309001
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Protocadherin 20 (PCDH20) Antibody (Biotin)
    20-abx309002
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Protocadherin 20 (PCDH20) Polyclonal Antibody (Human)
    4-PAE100Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20)
    Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), APC
    4-PAE100Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with APC.
    Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), Biotinylated
    4-PAE100Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with Biotin.
    Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), Cy3
    4-PAE100Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with Cy3.
    Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), FITC
    4-PAE100Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with FITC.
    Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), HRP
    4-PAE100Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with HRP.
    Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), PE
    4-PAE100Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with PE.
    Protocadherin 20 (PCDH20) Polyclonal Antibody (Human), APC-Cy7
    4-PAE100Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PCDH20 (Arg64~Phe209)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protocadherin 20 (PCDH20). This antibody is labeled with APC-Cy7.
    PCDH20 ELISA Kit (Human) (OKCD00930)
    OKCD00930 96 Wells
    EUR 831
    Description: Description of target: Potential calcium-dependent cell-adhesion protein. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.126 ng/mL
    FGF-20, human recombinant
    4589-20
    EUR 277
    99445-20 DCT 20 X 150MM
    99445-20 250/pk
    EUR 119
    Description: Disposable Culture Tubes; DCT's, CGW
    20(S)-NotoginsenosideR2
    N2028-20 20 mg
    EUR 630
    Description: Extracted from Pseudo-ginseng;Store the product in sealed, cool and dry condition
    PCDH20 siRNA
    20-abx927872
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PCDH20 siRNA
    20-abx927873
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PCDH20 Antibody
    1-CSB-PA822719LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PCDH20. Recognizes PCDH20 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
    anti-PCDH20
    YF-PA26579 50 ul
    EUR 334
    Description: Mouse polyclonal to PCDH20
    20(R)Ginsenoside?Rh1
    N2192-20 20 mg
    EUR 514
    Description: Extracted from Panax ginseng C. A. Mey. dried roots;Store the product in sealed, cool and dry condition
    20(R)Ginsenoside Rg2
    N2195-20 20 mg
    EUR 224
    Description: Extracted from Panax ginseng C. A. Mey. dried roots;Store the product in sealed, cool and dry condition
    20(R)Ginsenoside Rg3
    N2198-20 20 mg
    EUR 514
    Description: Extracted from Panax ginseng C.A.Mey. roots;Store the product in sealed, cool and dry condition
    Human Protocadherin 1 ELISA kit
    E01P0064-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Protocadherin 1 ELISA kit
    E01P0064-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Protocadherin 1 ELISA kit
    E01P0064-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    DiagNano Gold Nanoparticle Passive Conjugation Kit, 20 nm
    GPK-20 1 kit
    EUR 715
    Human PCDH20 shRNA Plasmid
    20-abx962130
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human IL-20(Interleukin 20) ELISA Kit
    EH0190 96T
    EUR 524.1
    • Detection range: 62.5-4000 pg/ml
    • Uniprot ID: Q9NYY1
    • Alias: IL-20/IL20/ZCYTO10/IL10D
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml
    Human cytokeratin 20(CK-20)ELISA Kit
    GA-E1735HM-48T 48T
    EUR 289
    Human cytokeratin 20(CK-20)ELISA Kit
    GA-E1735HM-96T 96T
    EUR 466
    Human cytokeratin 20,CK-20 ELISA Kit
    201-12-1719 96 tests
    EUR 440
    • This cytokeratin 20 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Interleukin 20,IL-20 ELISA KIT
    201-12-2164 96 tests
    EUR 440
    • This Interleukin 20 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Interleukin 20(IL-20)ELISA Kit
    CSB-E15015h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 20 (IL-20) in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Interleukin 20(IL-20)ELISA Kit
    1-CSB-E15015h
    • EUR 678.00
    • EUR 4644.00
    • EUR 2467.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 20(IL-20) in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human cytokeratin 20,CK-20 ELISA Kit
    CN-04600H1 96T
    EUR 464
    Human cytokeratin 20,CK-20 ELISA Kit
    CN-04600H2 48T
    EUR 313
    Human Interleukin 20(IL-20)ELISA Kit
    QY-E04295 96T
    EUR 361
    Human cytokeratin 20(CK-20)ELISA Kit
    QY-E00973 96T
    EUR 361
    20UL FILTER TIPS FOR P-20
    TF-20 1000/pk
    EUR 418
    Description: Filter Tip; Filter Tips Pipette - Axygen
    ExoDNAPS? Circulating and Exosome-associated DNA Extraction Kit (Human Plasma/Serum, 20 reactions)
    K1230-20
    EUR 718
    PCDH20 Rabbit pAb
    A10428-100ul 100 ul
    EUR 308
    PCDH20 Rabbit pAb
    A10428-200ul 200 ul
    EUR 459
    PCDH20 Rabbit pAb
    A10428-20ul 20 ul
    EUR 183
    PCDH20 Rabbit pAb
    A10428-50ul 50 ul
    EUR 223
    PCDH20 Polyclonal Antibody
    A66378 100 µg
    EUR 570.55
    Description: reagents widely cited
    PCDH20 Polyclonal Antibody
    27434-100ul 100ul
    EUR 252
    PCDH20 Polyclonal Antibody
    27434-50ul 50ul
    EUR 187
    PCDH20 cloning plasmid
    CSB-CL822719HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2775
    • Sequence: atggggcgtctacatcgtcccaggagcagcaccagctacaggaacctgccgcatctgtttctgtttttcctcttcgtgggacccttcagctgcctcgggagttacagccgggccaccgagcttctgtacagcctaaacgagggactacccgcgggggtgctcatcggcagcctgg
    • Show more
    Description: A cloning plasmid for the PCDH20 gene.
    Anti-PCDH20 antibody
    STJ112460 100 µl
    EUR 277
    Description: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. This gene encodes a protein which contains 6 extracellular cadherin domains, a transmembrane domain and a cytoplasmic tail differing from those of the classical cadherins. Although its specific function is undetermined, the cadherin-related neuronal receptor is thought to play a role in the establishment and function of specific cell-cell connections in the brain.
    Anti-PCDH20 (2C3)
    YF-MA19261 100 ug
    EUR 363
    Description: Mouse monoclonal to PCDH20
    Anti-PCDH20 (1B7)
    YF-MA19262 100 ug
    EUR 363
    Description: Mouse monoclonal to PCDH20
    Human Protocadherin-1 (PCDH1) ELISA Kit
    abx517940-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Protocadherin β 2 ELISA kit
    E01P0065-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Protocadherin β 2 ELISA kit
    E01P0065-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Protocadherin β 2 ELISA kit
    E01P0065-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Protocadherin β 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    ELISA kit for Human Protocadherin-1
    EK3817 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Protocadherin-1 in samples from serum, plasma, tissue homogenates and other biological fluids.
    Human PCDH1/ Protocadherin-1 ELISA Kit
    E1870Hu 1 Kit
    EUR 571
    Human PCDH1(Protocadherin-1) ELISA Kit
    EH1850 96T
    EUR 567.6
    • Detection range: 0.312-20 ng/ml
    • Uniprot ID: Q08174
    • Alias: PCDH1/Protocadherin-1/Cadherin-like protein 1/Protocadherin-42/PC42/PCDH42/protocadherin 42/Protocadherin-42/cadherin-like 1
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
    Human PCDH15(Protocadherin 15) ELISA Kit
    EH3515 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: Q96QU1
    • Alias: PCDH15/CDHR15/DFNB23/PCDH15/USH1F/autosomal recessive 23/cadherin-related family member 15/DKFZp667A1711/protocadherin-15/protocadherin-related 15
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
    Human Protocadherin- 17, PCDH17 ELISA KIT
    ELI-12385h 96 Tests
    EUR 824
    Human Protocadherin- 23, DCHS2 ELISA KIT
    ELI-14603h 96 Tests
    EUR 824
    Human Protocadherin- 18, PCDH18 ELISA KIT
    ELI-21159h 96 Tests
    EUR 824
    Human Protocadherin- 12, PCDH12 ELISA KIT
    ELI-21514h 96 Tests
    EUR 824
    Human Protocadherin- 7, PCDH7 ELISA KIT
    ELI-22678h 96 Tests
    EUR 824
    Human Protocadherin- 1, PCDH1 ELISA KIT
    ELI-05280h 96 Tests
    EUR 824
    Human protocadherin 1(PCDH1)ELISA Kit
    GA-E0251HM-48T 48T
    EUR 289
    Human protocadherin 1(PCDH1)ELISA Kit
    GA-E0251HM-96T 96T
    EUR 466
    Human Protocadherin- 8, PCDH8 ELISA KIT
    ELI-35669h 96 Tests
    EUR 824
    Human Protocadherin- 15, PCDH15 ELISA KIT
    ELI-37484h 96 Tests
    EUR 824
    Human Protocadherin- 9, PCDH9 ELISA KIT
    ELI-37492h 96 Tests
    EUR 824
    Human Protocadherin- 16, DCHS1 ELISA KIT
    ELI-43183h 96 Tests
    EUR 824
    Human Protocadherin- 10, PCDH10 ELISA KIT
    ELI-45884h 96 Tests
    EUR 824
    Human Protocadherin- 19, PCDH19 ELISA KIT
    ELI-45885h 96 Tests
    EUR 824
    Human Protocadherin 15 (PCDH15) ELISA Kit
    20-abx152866
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Protocadherin 9 (PCDH9) ELISA Kit
    abx382086-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Protocadherin 1 (PCDH1) ELISA Kit
    abx251163-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.
    Human Protocadherin 15 (PCDH15) ELISA Kit
    abx252905-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.
    Human protocadherin 1,PCDH1 ELISA Kit
    201-12-0235 96 tests
    EUR 440
    • This protocadherin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Protocadherin 15 (PCDH15) ELISA Kit
    DLR-PCDH15-Hu-48T 48T
    EUR 517
    • Should the Human Protocadherin 15 (PCDH15) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin 15 (PCDH15) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human Protocadherin 15 (PCDH15) ELISA Kit
    DLR-PCDH15-Hu-96T 96T
    EUR 673
    • Should the Human Protocadherin 15 (PCDH15) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Protocadherin 15 (PCDH15) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human Protocadherin-10(PCDH10) ELISA kit
    CSB-EL017525HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-10 (PCDH10) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Protocadherin-10(PCDH10) ELISA kit
    1-CSB-EL017525HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-10(PCDH10) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Protocadherin-23(DCHS2) ELISA kit
    CSB-EL006545HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-23 (DCHS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Protocadherin-23(DCHS2) ELISA kit
    1-CSB-EL006545HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Protocadherin-23(DCHS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human protocadherin 1,PCDH1 ELISA Kit
    CN-04176H1 96T
    EUR 455
    Human protocadherin 1,PCDH1 ELISA Kit
    CN-04176H2 48T
    EUR 304
    Human Protocadherin 15 (PCDH15) ELISA Kit
    RD-PCDH15-Hu-48Tests 48 Tests
    EUR 521
    Human Protocadherin 15 (PCDH15) ELISA Kit
    RD-PCDH15-Hu-96Tests 96 Tests
    EUR 723
    Human Protocadherin 15 (PCDH15) ELISA Kit
    RDR-PCDH15-Hu-48Tests 48 Tests
    EUR 544
    Human Protocadherin 15 (PCDH15) ELISA Kit
    RDR-PCDH15-Hu-96Tests 96 Tests
    EUR 756
    Human Protocadherin 9(PCDH9)ELISA Kit
    QY-E00380 96T
    EUR 361
    Human Protocadherin 8(PCDH8)ELISA Kit
    QY-E00381 96T
    EUR 361
    Human Protocadherin 7(PCDH7)ELISA Kit
    QY-E00382 96T
    EUR 394
    Human Protocadherin 21(PCDH21)ELISA Kit
    QY-E00383 96T
    EUR 394
    Human Protocadherin 19(PCDH19)ELISA Kit
    QY-E00385 96T
    EUR 394
    Human Protocadherin 18(PCDH18)ELISA Kit
    QY-E00386 96T
    EUR 394
    Human Protocadherin 17(PCDH17)ELISA Kit
    QY-E00387 96T
    EUR 394
    Human Protocadherin 12(PCDH12)ELISA Kit
    QY-E00388 96T
    EUR 394
    Human Protocadherin 11(PCDH11)ELISA Kit
    QY-E00389 96T
    EUR 394
    Human Protocadherin 10(PCDH10)ELISA Kit
    QY-E00390 96T
    EUR 361
    Human protocadherin 1(PCDH1)ELISA Kit
    QY-E00391 96T
    EUR 361
    Human Protocadherin 15 (PCDH15) ELISA Kit
    SEE095Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.
    Human Protocadherin 15 (PCDH15) ELISA Kit
    SEE095Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.
    Human Protocadherin 15 (PCDH15) ELISA Kit
    SEE095Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.
    Human Protocadherin 15 (PCDH15) ELISA Kit
    SEE095Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protocadherin 15 (PCDH15) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protocadherin 15 (PCDH15) in Tissue homogenates, cell lysates and other biological fluids.
    Human Protocadherin 15 (PCDH15) ELISA Kit
    4-SEE095Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Protocadherin 15 elisa. Alternative names of the recognized antigen: USH1F
    • DFNB23
    • CDHR15
    • Deafness, Autosomal Recessive 23
    • Cadherin-Related Family Member 15
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protocadherin 15 (PCDH15) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    AXYGEN® GEL TRAY 20 X 20 CM FOR USE WITH 20 CM GEL BOX, UV TRANSPARENT
    HGB20-20-GT 1/pk
    EUR 97
    Description: Lab Equipment; Axygen Branded EQ
    Human CK-20/KRT20(Cytokeratin 20) ELISA Kit
    EH2822 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P35900
    • Alias: CK-20/KRT20/Protein IT/Cytokeratin-20(CK-20)/Keratin-20(K20)/Keratin, type I cytoskeletal 20
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
    ELISA kit for Human IL-20 (Interleukin 20)
    E-EL-H0279 1 plate of 96 wells
    EUR 534
    • Gentaur's IL-20 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-20. Standards or samples are added to the micro ELISA plate wells and combined with
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human IL-20 (Interleukin 20) in samples from Serum, Plasma, Cell supernatant
    Human Matrix Metalloproteinase 20(MMP-20)ELISA Kit
    QY-E02992 96T
    EUR 361
    TumorExoRNA? Tumor-derived exosome immunocapture and RNA extraction kit (20 reactions)
    K1221-20
    EUR 1219
    PCDH20 ORF Vector (Human) (pORF)
    ORF007560 1.0 ug DNA
    EUR 95
    AXYGEN® HORIZONTAL GEL BOX, 20 CM
    HGB-20 1/pk
    EUR 541
    Description: Lab Equipment; Axygen Branded EQ
    DiagNano Silica-Coated Gold Nanoparticles, 20 nm
    CG-20 10mL
    EUR 719
    Rat Protocadherin 1 ELISA kit
    E02P0064-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Protocadherin 1 ELISA kit
    E02P0064-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Protocadherin 1 ELISA kit
    E02P0064-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Protocadherin 1 ELISA kit
    E03P0064-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Protocadherin 1 ELISA kit
    E03P0064-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Protocadherin 1 ELISA kit
    E03P0064-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Protocadherin 1 ELISA kit
    E04P0064-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Protocadherin 1 ELISA kit
    E04P0064-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Protocadherin 1 ELISA kit
    E04P0064-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Protocadherin 1 ELISA kit
    E06P0064-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Protocadherin 1 ELISA kit
    E06P0064-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Protocadherin 1 ELISA kit
    E06P0064-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Protocadherin 1 ELISA kit
    E07P0064-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Protocadherin 1 ELISA kit
    E07P0064-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Protocadherin 1 ELISA kit
    E07P0064-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Protocadherin 1 ELISA kit
    E08P0064-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Protocadherin 1 ELISA kit
    E08P0064-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Protocadherin 1 ELISA kit
    E08P0064-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Protocadherin 1 ELISA kit
    E09P0064-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Protocadherin 1 ELISA kit
    E09P0064-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Protocadherin 1 ELISA kit
    E09P0064-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Protocadherin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human CytoKeratin 20 ELISA kit
    E01C0764-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human CytoKeratin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human CytoKeratin 20 ELISA kit
    E01C0764-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human CytoKeratin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human CytoKeratin 20 ELISA kit
    E01C0764-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human CytoKeratin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Interleukin 20 ELISA kit
    E01I0013-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Interleukin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Interleukin 20 ELISA kit
    E01I0013-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Interleukin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Interleukin 20 ELISA kit
    E01I0013-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Interleukin 20 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human CK 20 ELISA Kit
    EHC0771 96Tests
    EUR 521
    Human HSP-20 ELISA Kit
    EHH0292 96Tests
    EUR 521
    IL-20 ELISA KIT|Human
    EF000154 96 Tests
    EUR 689
    Human Keratin 20 ELISA Kit
    ELA-E9127h 96 Tests
    EUR 824
    Cadherin-20 ELISA KIT|Human
    EF008335 96 Tests
    EUR 689
    Human IL-20 ELISA Kit
    LF-EK50865 1×96T
    EUR 648
    Human IL-20 ELISA Kit
    RK00180 96 Tests
    EUR 521
    99447 DSSCT 20 X 125 W/ MARKING SPOT
    99447-20 250/pk
    EUR 211
    Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock
    DiagNano Silica-Coated PEGylated Gold Nanoparticles, 20 nm
    PG-20 10mL
    EUR 719
    IL-20 ELISA Kit| Rat Interleukin 20 ELISA Kit
    EF018189 96 Tests
    EUR 689
    Human Protocadherin alpha-1 (PCDHA1) ELISA Kit
    abx516593-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    ELISA kit for Human PCDH1 (Protocadherin 1)
    E-EL-H2264 1 plate of 96 wells
    EUR 534
    • Gentaur's PCDH1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human PCDH1. Standards or samples are added to the micro ELISA plate wells and combined with
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human PCDH1 (Protocadherin 1) in samples from Serum, Plasma, Cell supernatant
    Human PCDHA1/ Protocadherin alpha-1 ELISA Kit
    E1871Hu 1 Kit
    EUR 571
    Human PCDHβ16(Protocadherin Beta 16) ELISA Kit
    EH3516 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: Q9NRJ7
    • Alias: PCDHβ16
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
    Human PCDHγA2(Protocadherin Gamma A2) ELISA Kit
    EH3518 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: Q9Y5H1
    • Alias: PCDHγA2
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
    Human Protocadherin Fat 2, FAT2 ELISA KIT
    ELI-09784h 96 Tests
    EUR 824
    Human Protocadherin Fat 3, FAT3 ELISA KIT
    ELI-09785h 96 Tests
    EUR 824
    Human Protocadherin beta- 10, PCDHB10 ELISA KIT
    ELI-12387h 96 Tests
    EUR 824
    Human Protocadherin gamma- A7, PCDHGA7 ELISA KIT
    ELI-12388h 96 Tests
    EUR 824
    Human Protocadherin gamma- A12, PCDHGA12 ELISA KIT
    ELI-12389h 96 Tests
    EUR 824
    Human Protocadherin alpha- 10, PCDHA10 ELISA KIT
    ELI-14581h 96 Tests
    EUR 824
    Human Protocadherin beta- 15, PCDHB15 ELISA KIT
    ELI-14582h 96 Tests
    EUR 824
    Human Protocadherin gamma- B3, PCDHGB3 ELISA KIT
    ELI-14583h 96 Tests
    EUR 824
    Human Protocadherin gamma- C3, PCDHGC3 ELISA KIT
    ELI-14584h 96 Tests
    EUR 824
    Human Protocadherin beta- 4, PCDHB4 ELISA KIT
    ELI-14604h 96 Tests
    EUR 824
    Human Protocadherin beta- 5, PCDHB5 ELISA KIT
    ELI-14605h 96 Tests
    EUR 824
    Human Protocadherin beta- 9, PCDHB9 ELISA KIT
    ELI-14606h 96 Tests
    EUR 824
    Human Protocadherin beta- 14, PCDHB14 ELISA KIT
    ELI-14607h 96 Tests
    EUR 824
    Human Protocadherin beta- 16, PCDHB16 ELISA KIT
    ELI-14608h 96 Tests
    EUR 824
    Human Protocadherin gamma- B5, PCDHGB5 ELISA KIT
    ELI-14609h 96 Tests
    EUR 824
    Human Protocadherin alpha- 5, PCDHA5 ELISA KIT
    ELI-21160h 96 Tests
    EUR 824
    Human Protocadherin alpha- C2, PCDHAC2 ELISA KIT
    ELI-21161h 96 Tests
    EUR 824
    Human Protocadherin gamma- B4, PCDHGB4 ELISA KIT
    ELI-21515h 96 Tests
    EUR 824
    Human Protocadherin gamma- A3, PCDHGA3 ELISA KIT
    ELI-21875h 96 Tests
    EUR 824
    Human Protocadherin gamma- C4, PCDHGC4 ELISA KIT
    ELI-21876h 96 Tests
    EUR 824
    Human Protocadherin gamma- C5, PCDHGC5 ELISA KIT
    ELI-21877h 96 Tests
    EUR 824
    Human Protocadherin alpha- 8, PCDHA8 ELISA KIT
    ELI-22836h 96 Tests
    EUR 824
    Human Protocadherin gamma- B2, PCDHGB2 ELISA KIT
    ELI-22838h 96 Tests
    EUR 824