Human CXADR(Coxsackie Virus And Adenovirus Receptor) ELISA Kit

Human CXADR(Coxsackie Virus And Adenovirus Receptor) ELISA Kit

To Order Contact us: 

Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
RD-CXADR-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
RD-CXADR-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
20-abx111814	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
20-abx129234	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
20-abx327696	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
abx330911-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
20-abx171940	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Coxsackie Virus And Adenovirus Receptor (CXADR)
4-RPJ305Hu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P78310 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Coxsackie Virus And Adenovirus Receptor expressed in: E.coli

Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
20-abx151211	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
SEJ305Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% I Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.

Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
SEJ305Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% I Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.

Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
SEJ305Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% I Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.

Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
SEJ305Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% I Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.

Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
4-SEJ305Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Coxsackie Virus And Adenovirus Receptor elisa. Alternative names of the recognized antigen: CAR HCAR HCVADR CVB3-binding protein Coxsackievirus B-adenovirus receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Coxsackie Virus And Adenovirus Receptor (CXADR) Protein
20-abx168282	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Coxsackie Virus And Adenovirus Receptor (CXADR) CLIA Kit
20-abx495676	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human CXADR (Coxsackie Virus And Adenovirus Receptor)
ELK4785	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Coxsackie Virus And Adenovirus Receptor (CXADR). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibod Show more
Description: A sandwich ELISA kit for detection of Coxsackie Virus And Adenovirus Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

CXADR Coxsackie Virus And Adenovirus Receptor Human Recombinant Protein
PROTP78310	BosterBio	Regular: 20ug	EUR 317
Description: CXADR Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 241 amino acids (20-237) and having a molecular mass of 26.0kDa.;CXADR is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat)
4-PAJ305Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CXADR (Leu20~Val229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR)

Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), APC
4-PAJ305Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CXADR (Leu20~Val229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with APC.

Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAJ305Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CXADR (Leu20~Val229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with Biotin.

Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), Cy3
4-PAJ305Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CXADR (Leu20~Val229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with Cy3.

Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), FITC
4-PAJ305Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CXADR (Leu20~Val229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with FITC.

Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), HRP
4-PAJ305Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CXADR (Leu20~Val229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with HRP.

Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), PE
4-PAJ305Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CXADR (Leu20~Val229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with PE.

Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAJ305Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CXADR (Leu20~Val229) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with APC-Cy7.

Anti-Coxsackie Adenovirus Receptor/CXADR Antibody
PA1852	BosterBio	100ug/vial	EUR 294

Human CXADR/ Coxsackievirus and adenovirus receptor ELISA Kit
E0613Hu	Sunlong	1 Kit	EUR 605

Human CXADR(Coxsackievirus and adenovirus receptor) ELISA Kit
EH1547	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: P78310 Alias: CXADR(Coxsackie virus and adenovirus receptor/coxsackie virus B receptor)/CAR/CVB3 BP/HCAR/HCVADR/CAR10/Coxsackievirus B-adenovirus receptor/CAR4,6/CVB3 binding protein/CVB3-binding protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human Coxsackievirus and adenovirus receptor, CXADR ELISA KIT
ELI-04539h	Lifescience Market	96 Tests	EUR 824

Human Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
abx250834-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Coxsackievirus and adenovirus receptor(CXADR) ELISA kit
CSB-EL006237HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Coxsackievirus and adenovirus receptor (CXADR) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Coxsackievirus and adenovirus receptor(CXADR) ELISA kit
1-CSB-EL006237HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Coxsackievirus and adenovirus receptor(CXADR) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
20-abx001505	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
20-abx009371	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
abx031745-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
abx031745-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
20-abx014400	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
20-abx301167	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
abx232091-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Cow Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
abx516680-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
abx516682-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
abx516683-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

anti-Coxsackie Adenovirus Receptor
YF-PA11220	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Coxsackie Adenovirus Receptor

anti-Coxsackie Adenovirus Receptor
YF-PA11221	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Coxsackie Adenovirus Receptor

Coxsackievirus And Adenovirus Receptor (CXADR) Antibody (HRP)
20-abx303541	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Coxsackievirus And Adenovirus Receptor (CXADR) Antibody (FITC)
20-abx303542	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Coxsackievirus And Adenovirus Receptor (CXADR) Antibody (Biotin)
20-abx303543	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
20-abx151097	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
DLR-CLMP-Hu-48T	DL Develop	48T	EUR 554
Should the Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
DLR-CLMP-Hu-96T	DL Develop	96T	EUR 725
Should the Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
RDR-CLMP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
RDR-CLMP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
RD-CLMP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
RD-CLMP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
SEW786Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
SEW786Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
SEW786Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
SEW786Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
4-SEW786Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Coxsackie And Adenovirus Receptor Like Membrane Protein elisa. Alternative names of the recognized antigen: ACAM ASAM Adipocyte Adhesion Molecule Adipocyte-Specific Adhesion Molecule CXADR Like Membrane Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human CLMP (Coxsackie And Adenovirus Receptor Like Membrane Protein)
ELK7178	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-con Show more
Description: A sandwich ELISA kit for detection of Coxsackie And Adenovirus Receptor Like Membrane Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) CLIA Kit
20-abx496287	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Antibody
20-abx130591	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Antibody
20-abx171939	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Recombinant Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP)
4-RPW786Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9H6B4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.5kDa Isoelectric Point: Inquire
Description: Recombinant Human Coxsackie And Adenovirus Receptor Like Membrane Protein expressed in: E.coli

Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Protein
20-abx650838	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human)
4-PAW786Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLMP (Thr19~Ser183) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP)

Human Coxsackie Virus IgM ELISA Kit
abx052809-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), APC
4-PAW786Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLMP (Thr19~Ser183) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with APC.

Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), Biotinylated
4-PAW786Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLMP (Thr19~Ser183) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with Biotin.

Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), Cy3
4-PAW786Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLMP (Thr19~Ser183) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with Cy3.

Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), FITC
4-PAW786Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLMP (Thr19~Ser183) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with FITC.

Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), HRP
4-PAW786Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLMP (Thr19~Ser183) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with HRP.

Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), PE
4-PAW786Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLMP (Thr19~Ser183) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with PE.

Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), APC-Cy7
4-PAW786Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CLMP (Thr19~Ser183) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with APC-Cy7.

ELISA kit for Human Coxsackievirus and adenovirus receptor
EK3312	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Coxsackievirus and adenovirus receptor in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Coxsackie virus IgG(Cox V-IgG)ELISA Kit
GA-E1759HM-48T	GenAsia Biotech	48T	EUR 289

Human Coxsackie virus IgG(Cox V-IgG)ELISA Kit
GA-E1759HM-96T	GenAsia Biotech	96T	EUR 466

Human Coxsackie virus IgM(Cox V-IgM)ELISA Kit
GA-E1823HM-48T	GenAsia Biotech	48T	EUR 289

Human Coxsackie virus IgM(Cox V-IgM)ELISA Kit
GA-E1823HM-96T	GenAsia Biotech	96T	EUR 466

Human Coxsackie virus IgG,Cox V-IgG ELISA Kit
201-12-1743	SunredBio	96 tests	EUR 440
This Coxsackie virus IgG ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Coxsackie virus IgM,Cox V-IgM ELISA Kit
201-12-1807	SunredBio	96 tests	EUR 440
This Coxsackie virus IgM ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Coxsackie virus IgM(Cox V-IgM)ELISA Kit
QY-E02492	Qayee Biotechnology	96T	EUR 394

Human Coxsackie virus IgG(Cox V-IgG)ELISA Kit
QY-E02493	Qayee Biotechnology	96T	EUR 394

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Cxadr/ Rat Cxadr ELISA Kit
ELI-04538r	Lifescience Market	96 Tests	EUR 886

ELISA kit for Human Coxsackie virus (Cox V) antibody (IgG)
EK0187	SAB	96 tests	EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Coxsackie virus (Cox V) antibody (IgG) in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Coxsackie virus (Cox V) antibody (IgM)
EK0188	SAB	96 tests	EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Coxsackie virus (Cox V) antibody (IgM) in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Coxsackie virus IgM (Cox V-IgM)
KTE62276-48T	Abbkine	48T	EUR 332
Immunoglobulin M, or IgM for short, is a basic antibody that is present on B cells. It is the primary antibody against A and B antigens on red blood cells. IgM is by far the physically largest antibody in the human circulatory system. It is produced Show more
Description: Quantitative sandwich ELISA for measuring Human Coxsackie virus IgM (Cox V-IgM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Coxsackie virus IgM (Cox V-IgM)
KTE62276-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Immunoglobulin M, or IgM for short, is a basic antibody that is present on B cells. It is the primary antibody against A and B antigens on red blood cells. IgM is by far the physically largest antibody in the human circulatory system. It is produced Show more
Description: Quantitative sandwich ELISA for measuring Human Coxsackie virus IgM (Cox V-IgM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Coxsackie virus IgM (Cox V-IgM)
KTE62276-96T	Abbkine	96T	EUR 539
Immunoglobulin M, or IgM for short, is a basic antibody that is present on B cells. It is the primary antibody against A and B antigens on red blood cells. IgM is by far the physically largest antibody in the human circulatory system. It is produced Show more
Description: Quantitative sandwich ELISA for measuring Human Coxsackie virus IgM (Cox V-IgM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Virus Adenovirus (ADV) Protein
abx670001-1ml	Abbexa	1 ml	EUR 620
Shipped within 1 week.

Human CXADR ELISA Kit
ELA-E13929h	Lifescience Market	96 Tests	EUR 824

CXADR ELISA KIT|Human
EF005677	Lifescience Market	96 Tests	EUR 689

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Mouse Cxadr ELISA KIT
ELI-04537m	Lifescience Market	96 Tests	EUR 865

Bovine CXADR ELISA KIT
ELI-04540b	Lifescience Market	96 Tests	EUR 928

Human Adenovirus (ADV) ELISA Kit
abx052689-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Coxsackie A PCR kit
PCR-H720-48D	Bioingentech	50T	EUR 425.8
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Coxsackie A

Coxsackie A PCR kit
PCR-H720-96D	Bioingentech	100T	EUR 521.5
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Coxsackie A

Coxsackie B PCR kit
PCR-H721-48D	Bioingentech	50T	EUR 425.8
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Coxsackie B

Coxsackie B PCR kit
PCR-H721-96D	Bioingentech	100T	EUR 521.5
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Coxsackie B

Mouse CXADR PicoKine ELISA Kit
EK1725	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse CXADR in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Rat CXADR PicoKine ELISA Kit
EK1726	BosterBio	96 wells	EUR 425
Description: For quantitative detection of rat CXADR in cell culture supernates, serum and plasma (heparin, EDTA, citrate).

Adenovirus IgA ELISA kit
55R-IB79201	Fitzgerald	96 wells	EUR 316
Description: ELISA kit for the detection of Adenovirus IgA in the research laboratory

Adenovirus IgG ELISA kit
55R-IB79202	Fitzgerald	96 wells	EUR 330
Description: ELISA kit for the detection of Adenovirus IgG in the research laboratory

Adenovirus IgM ELISA kit
55R-IB79203	Fitzgerald	96 wells	EUR 319
Description: ELISA kit for the detection of Adenovirus IgM in the research laboratory

Adenovirus IgG ELISA Kit
DEIA309	Creative Diagnostics	96T	EUR 650
Description: The Adenovirus IgG Antibody ELISA Test Kit has been designed for the the detection and the quantitative determination of specific IgG antibodies against Adenovirus in serum and plasma.

Adenovirus IgA ELISA Kit
DEIA310	Creative Diagnostics	96T	EUR 650
Description: The Adenovirus IgA Antibody ELISA Test Kit has been designed for the the detection and the quantitative determination of specific IgA antibodies against Adenovirus in serum and plasma.

Adenovirus IgM ELISA Kit
DEIA311	Creative Diagnostics	96T	EUR 650
Description: The Adenovirus IgM Antibody ELISA Test Kit has been designed forthe the detection and the quantitative determination of specific IgM antibodies against Adenovirus in serum and plasma.

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Virus Adenovirus Type 5 (ADV-5) Protein
abx670093-01mg	Abbexa	0.1 mg	EUR 453
Shipped within 1 week.

Human CXADR Antibody
32643-05111	AssayPro	150 ug	EUR 261

Human Adenovirus 36 (ADV36) ELISA Kit
abx051985-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Coxsackie A RT PCR kit
RTq-H720-100D	Bioingentech	100T	EUR 628.5
Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie A .

Coxsackie A RT PCR kit
RTq-H720-150D	Bioingentech	150T	EUR 701
Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie A .

Coxsackie A RT PCR kit
RTq-H720-50D	Bioingentech	50T	EUR 532.8
Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie A .

Coxsackie B RT PCR kit
RTq-H721-100D	Bioingentech	100T	EUR 628.5
Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie B .

Coxsackie B RT PCR kit
RTq-H721-150D	Bioingentech	150T	EUR 701
Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie B .

Coxsackie B RT PCR kit
RTq-H721-50D	Bioingentech	50T	EUR 532.8
Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie B .

Mouse Adenovirus (ADV) ELISA Kit
abx055024-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Rat Adenovirus (ADV) ELISA Kit
abx055049-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

QuickTiter Adenovirus Titer ELISA Kit
VPK-110	Cell Biolabs	2 x 96 assays	EUR 699
Description: Accurate measurement of adenovirus titer is critical for gene delivery. Traditional plaque-forming unit (PFU) assays are long and suffer from high inter-assay variability. The QuickTiter Adenovirus Titer ELISA Kit provides a quick, complete system to functionally titer virus infectivity. The assay recognizes all 41 serotypes of adenovirus, and can be used with any adenovirus system that can amplify in HEK 293 cells.

CXADR siRNA
20-abx901347	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CXADR Protein
20-abx261108	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

CXADR siRNA
20-abx913231	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CXADR siRNA
20-abx913232	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CXADR antibody
70R-49623	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal CXADR antibody

CXADR antibody
70R-35487	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal CXADR antibody

CXADR antibody
70R-6982	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CXADR antibody raised against the N terminal of CXADR

CXADR Antibody
ABD3973	Lifescience Market	100 ug	EUR 438

CXADR Antibody
ABD6638	Lifescience Market	100 ug	EUR 438

CXADR Antibody
34624-100ul	SAB	100ul	EUR 252

CXADR Antibody
34624-50ul	SAB	50ul	EUR 187

CXADR Antibody
32451-100ul	SAB	100ul	EUR 252

CXADR antibody
70R-16680	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CXADR antibody

CXADR Antibody
DF6638	Affbiotech	200ul	EUR 304
Description: CXADR Antibody detects endogenous levels of total CXADR.

CXADR Antibody
DF3973	Affbiotech	200ul	EUR 304
Description: CXADR Antibody detects endogenous levels of total CXADR.

CXADR Antibody
1-CSB-PA001210	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CXADR Antibody
1-CSB-PA006237GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CXADR Antibody
1-CSB-PA006237LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CXADR Antibody
CSB-PA830526-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

CXADR Antibody
CSB-PA830526-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

Adenovirus PCR kit
PCR-H501-48D	Bioingentech	50T	EUR 425.8
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Adenovirus

Adenovirus PCR kit
PCR-H501-96D	Bioingentech	100T	EUR 521.5
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Adenovirus

Adenovirus Purification Kit
K1459-100	Biovision	100 Preps	EUR 1037

Adenovirus Purification Kit
K1459-20	Biovision	20 Preps	EUR 606

Human CXADR- like membrane protein, CLMP ELISA KIT
ELI-25612h	Lifescience Market	96 Tests	EUR 824

Human Adenovirus Antigen(ADV-Ag)ELISA Kit
GA-E1760HM-48T	GenAsia Biotech	48T	EUR 289

Human Adenovirus Antigen(ADV-Ag)ELISA Kit
GA-E1760HM-96T	GenAsia Biotech	96T	EUR 466

Human Adenovirus IgM(ADV-IgM)ELISA Kit
GA-E1780HM-48T	GenAsia Biotech	48T	EUR 289

Human Adenovirus IgM(ADV-IgM)ELISA Kit
GA-E1780HM-96T	GenAsia Biotech	96T	EUR 466

Human Adenovirus IgG(ADV-IgG)ELISA Kit
GA-E1784HM-48T	GenAsia Biotech	48T	EUR 289

Human Adenovirus IgG(ADV-IgG)ELISA Kit
GA-E1784HM-96T	GenAsia Biotech	96T	EUR 466

Human Adenovirus Antigen,ADV-Ag ELISA Kit
201-12-1744	SunredBio	96 tests	EUR 440
This Adenovirus Antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Adenovirus IgM,ADV-IgM ELISA Kit
201-12-1764	SunredBio	96 tests	EUR 440
This Adenovirus IgM ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Adenovirus IgG,ADV-IgG ELISA Kit
201-12-1768	SunredBio	96 tests	EUR 440
This Adenovirus IgG ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Adenovirus (ADV)antibody(IgG)ELISA Kit
CSB-E05005h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human Adenovirus (ADV)antibody (IgG) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Adenovirus (ADV)antibody(IgG)ELISA Kit
1-CSB-E05005h	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human Adenovirus (ADV)antibody(IgG) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human adenovirus (ADV) antibody (IgM) ELISA kit
CSB-E05006h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human adenovirus (ADV) antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human adenovirus (ADV) antibody (IgM) ELISA kit
1-CSB-E05006h	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human adenovirus (ADV) antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Adenovirus Antigen(ADV-Ag)ELISA Kit
QY-E00882	Qayee Biotechnology	96T	EUR 361

Human Adenovirus IgM(ADV-IgM)ELISA Kit
QY-E00883	Qayee Biotechnology	96T	EUR 361

Human Adenovirus IgG(ADV-IgG)ELISA Kit
QY-E00884	Qayee Biotechnology	96T	EUR 361

Human Immunodeficiency Virus (1+2) Antigen and Antibody ELISA Kit
DEIA066	Creative Diagnostics	96T	EUR 502
Description: This HIV 1+2 Ag/Ab ELISA is an enzyme-linked immunosorbent assay (ELISA) intended for qualitative detection of antigens and/or antibodies to Human Immunodeficiency Viruses (HIV) type 1(group M - O) and/or type 2 in human serum or plasma samples. The method is also known as 4th generation ELISA for HIV detection. The kit is intended for screening of blood donors and as an aid in the diagnosis of clinical conditions related to infection with HIV-1 and/or HIV-2 - the etiological agents of the acquired immunodeficiency syndrome (AIDS).

Human CXADR shRNA Plasmid
20-abx951080	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

CXADR Recombinant Protein (Human)
RP008422	ABM	100 ug	Ask for price

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Pig Reproductive and Respiratory Syndrome Virus Antibody ELISA Kit
abx364909-96tests	Abbexa	96 tests	EUR 543
Shipped within 5-10 working days.

Virus Foot and Mouth Disease Virus Non-Structural Protein (FMDV NSP) ELISA Kit
abx055782-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Coxsackie A One-Step PCR kit
Oneq-H720-100D	Bioingentech	100T	EUR 747.4
Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie A.

Coxsackie A One-Step PCR kit
Oneq-H720-150D	Bioingentech	150T	EUR 838.75
Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie A.

Coxsackie A One-Step PCR kit
Oneq-H720-50D	Bioingentech	50T	EUR 628.5
Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie A.

Coxsackie B One-Step PCR kit
Oneq-H721-100D	Bioingentech	100T	EUR 747.4
Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie B.

Coxsackie B One-Step PCR kit
Oneq-H721-150D	Bioingentech	150T	EUR 838.75
Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie B.

Coxsackie B One-Step PCR kit
Oneq-H721-50D	Bioingentech	50T	EUR 628.5
Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie B.

Mouse Adenovirus antibody (IgG) ELISA Kit
CSB-E13901m-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Mouse Adenovirus antibody (IgG) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Adenovirus antibody (IgG) ELISA Kit
1-CSB-E13901m	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Mouse Adenovirus antibody (IgG) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Foot and mouth disease virus PCR kit
PCR-V225-48R	Bioingentech	50T	EUR 524.4
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Foot and mouth disease virus

Foot and mouth disease virus PCR kit
PCR-V225-96R	Bioingentech	100T	EUR 669.4
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Foot and mouth disease virus

ELISA kit for Human Adenovirus (ADV)antibody (IgG)ELISA Kit
EK0129	SAB	96 tests	EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenovirus (ADV)antibody (IgG)ELISA Kit in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human adenovirus (ADV) antibody (IgM)
EK0128	SAB	96 tests	EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Human adenovirus (ADV) antibody (IgM) in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Adenovirus Antibody IgG (ADV IgG) ELISA Kit
abx052155-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Human Adenovirus Antibody IgM (ADV IgM) ELISA Kit
abx052156-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Human Adenovirus 36 Antibody (ADV36 Ab) ELISA Kit
abx053094-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Human Adenovirus Type 5 (ADV-5) ELISA Kit
abx055308-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-10 working days.

Human Adenovirus (ADV) IgA (ADV IgA) ELISA Kit
abx364853-96tests	Abbexa	96 tests	EUR 511
Shipped within 5-12 working days.

Human Adenovirus (ADV) IgG (ADV IgG) ELISA Kit
abx364854-96tests	Abbexa	96 tests	EUR 511
Shipped within 5-12 working days.

Human Adenovirus (ADV) IgM (ADV IgM) ELISA Kit
abx364855-96tests	Abbexa	96 tests	EUR 511
Shipped within 5-12 working days.

ELISA kit for Human Adenovirus IgA (ADV-IgA)
KTE62701-48T	Abbkine	48T	EUR 332
Adenoviruses (members of the family Adenoviridae) are medium-sized (90?100 nm), nonenveloped (without an outer lipid bilayer) viruses with an icosahedral nucleocapsid containing a double stranded DNA genome. Their name derives from their initial isol Show more
Description: Quantitative sandwich ELISA for measuring Human Adenovirus IgA (ADV-IgA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adenovirus IgA (ADV-IgA)
KTE62701-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Adenoviruses (members of the family Adenoviridae) are medium-sized (90?100 nm), nonenveloped (without an outer lipid bilayer) viruses with an icosahedral nucleocapsid containing a double stranded DNA genome. Their name derives from their initial isol Show more
Description: Quantitative sandwich ELISA for measuring Human Adenovirus IgA (ADV-IgA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Adenovirus IgA (ADV-IgA)
KTE62701-96T	Abbkine	96T	EUR 539
Adenoviruses (members of the family Adenoviridae) are medium-sized (90?100 nm), nonenveloped (without an outer lipid bilayer) viruses with an icosahedral nucleocapsid containing a double stranded DNA genome. Their name derives from their initial isol Show more
Description: Quantitative sandwich ELISA for measuring Human Adenovirus IgA (ADV-IgA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Adenovirus Mini Purification Kit
K1300-10	Biovision		EUR 544

Adenovirus Mini Purification Kit
K1300-20	Biovision		EUR 914

Adenovirus Maxi Purification Kit
K1301-10	Biovision		EUR 1295

Adenovirus Maxi Purification Kit
K1301-2	Biovision		EUR 533

Adenovirus Maxi Purification Kit
K1301-4	Biovision		EUR 860

Falcon adenovirus PCR kit
PCR-V017-48D	Bioingentech	50T	EUR 425.8
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Falcon adenovirus

Falcon adenovirus PCR kit
PCR-V017-96D	Bioingentech	100T	EUR 521.5
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Falcon adenovirus

Fowl Adenovirus PCR kit
PCR-V040-48D	Bioingentech	50T	EUR 425.8
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Fowl Adenovirus

Fowl Adenovirus PCR kit
PCR-V040-96D	Bioingentech	100T	EUR 521.5
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Fowl Adenovirus

Reptil Adenovirus PCR kit
PCR-V308-48D	Bioingentech	50T	EUR 425.8
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Reptil Adenovirus

Reptil Adenovirus PCR kit
PCR-V308-96D	Bioingentech	100T	EUR 521.5
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Reptil Adenovirus

Mouse Adenovirus PCR kit
PCR-V366-48D	Bioingentech	50T	EUR 425.8
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Mouse Adenovirus

Mouse Adenovirus PCR kit
PCR-V366-96D	Bioingentech	100T	EUR 521.5
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Mouse Adenovirus

Porcine adenovirus PCR kit
PCR-V726-48D	Bioingentech	50T	EUR 425.8
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Porcine adenovirus

Porcine adenovirus PCR kit
PCR-V726-96D	Bioingentech	100T	EUR 521.5
Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Porcine adenovirus

Adenovirus RT PCR kit
RTq-H501-100D	Bioingentech	100T	EUR 628.5
Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Adenovirus .

Adenovirus RT PCR kit
RTq-H501-150D	Bioingentech	150T	EUR 701
Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Adenovirus .

Adenovirus RT PCR kit
RTq-H501-50D	Bioingentech	50T	EUR 532.8
Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Adenovirus .

ViraBind Adenovirus Miniprep Kit
VPK-099	Cell Biolabs	10 preps	EUR 612
Description: Purification of viruses via cesium chloride ultracentrifugation procedures can be tedious and time-consuming. ViraBind Adenovirus Purification Kits provide a much more efficient system for fast adenoviral purification with high yields. The ViraBind Adenovirus Miniprep Kit uses a special spin column to purify supernatant from a single T75 flask or 10cm dish per prep in about 30 minutes.

QuickTiter Adenovirus Quantitation Kit
VPK-106	Cell Biolabs	20 assays	EUR 711
Description: Quantifying your adenovirus prep prior to infection will help you determine the amount of virus needed to achieve the appropriate MOI (multiplicity of infection) for your target cells. Our QuickTiter Adenovirus Quantitation Kit provides a quick method for measuring the viral nucleic acid content of your adenovirus. This assay may be performed either before or after purification of your virus.

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Monoclonal CXADR Antibody
APG02918G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human CXADR. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC

Polyclonal CXADR Antibody
APG02919G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXADR . This antibody is tested and proven to work in the following applications:

CXADR Conjugated Antibody
C32451	SAB	100ul	EUR 397

CXADR cloning plasmid
CSB-CL006237HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1098 Sequence: atggcgctcctgctgtgcttcgtgctcctgtgcggagtagtggatttcgccagaagtttgagtatcactactcctgaagagatgattgaaaaagccaaaggggaaactgcctatctgccgtgcaaatttacgcttagtcccgaagaccagggaccgctggacatcgagtggctga Show more
Description: A cloning plasmid for the CXADR gene.

anti- CXADR antibody
FNab02091	FN Test	100µg	EUR 505.25
Immunogen: coxsackie virus and adenovirus receptor Uniprot ID: P78310 Gene ID: 1525 Research Area: Immunology
Description: Antibody raised against CXADR

CXADR Blocking Peptide
20-abx062498	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

CXADR Polyclonal Antibody
A58698	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

CXADR Rabbit pAb
A1822-100ul	Abclonal	100 ul	EUR 308

CXADR Rabbit pAb
A1822-200ul	Abclonal	200 ul	EUR 459

CXADR Rabbit pAb
A1822-20ul	Abclonal	20 ul	EUR 183

CXADR Rabbit pAb
A1822-50ul	Abclonal	50 ul	EUR 223

CXADR Blocking Peptide
33R-4065	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXADR antibody, catalog no. 70R-6982

CXADR Blocking Peptide
DF6638-BP	Affbiotech	1mg	EUR 195

CXADR Blocking Peptide
DF3973-BP	Affbiotech	1mg	EUR 195

Anti-CXADR antibody
PAab02091	Lifescience Market	100 ug	EUR 355

pCMV-SPORT6-CXADR
PVT13265	Lifescience Market	2 ug	EUR 391

Anti-CXADR antibody
STJ23296	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a type I membrane receptor for group B coxsackieviruses and subgroup C adenoviruses. Several transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene are found on chromosomes 15, 18, and 21.

Virus DNA extraction and purification
EP10015	Neuromics	100 Tests	EUR 505

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Cattle and Goat Foot and Mouth Disease Virus Type O Antibody ELISA Kit
abx364926-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-10 working days.

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Human CXADR Antibody (Biotin Conjugate)
32643-05121	AssayPro	150 ug	EUR 369

CXADR ORF Vector (Human) (pORF)
ORF002808	ABM	1.0 ug DNA	EUR 95

Recombinant Human CXADR/CAR Protein
RP00238	Abclonal	10 μg	EUR 155