Human CXADR(Coxsackie Virus And Adenovirus Receptor) ELISA Kit

Human CXADR(Coxsackie Virus And Adenovirus Receptor) ELISA Kit

To Order Contact us: 

Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
RD-CXADR-Hu-48Tests 48 Tests
EUR 521
Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
RD-CXADR-Hu-96Tests 96 Tests
EUR 723
Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
20-abx111814
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
20-abx129234
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
20-abx327696
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
abx330911-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
20-abx171940
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Coxsackie Virus And Adenovirus Receptor (CXADR)
4-RPJ305Hu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P78310
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Coxsackie Virus And Adenovirus Receptor expressed in: E.coli
Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
20-abx151211
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
SEJ305Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.
Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
SEJ305Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.
Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
SEJ305Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.
Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
SEJ305Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • I
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.
Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
4-SEJ305Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Coxsackie Virus And Adenovirus Receptor elisa. Alternative names of the recognized antigen: CAR
  • HCAR
  • HCVADR
  • CVB3-binding protein
  • Coxsackievirus B-adenovirus receptor
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Coxsackie Virus And Adenovirus Receptor (CXADR) Protein
20-abx168282
  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Human Coxsackie Virus And Adenovirus Receptor (CXADR) CLIA Kit
20-abx495676
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
ELISA kit for Human CXADR (Coxsackie Virus And Adenovirus Receptor)
ELK4785 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Coxsackie Virus And Adenovirus Receptor (CXADR). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibod
  • Show more
Description: A sandwich ELISA kit for detection of Coxsackie Virus And Adenovirus Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
CXADR Coxsackie Virus And Adenovirus Receptor Human Recombinant Protein
PROTP78310 Regular: 20ug
EUR 317
Description: CXADR Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 241 amino acids (20-237) and having a molecular mass of 26.0kDa.;CXADR is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat)
4-PAJ305Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CXADR (Leu20~Val229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR)
Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), APC
4-PAJ305Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CXADR (Leu20~Val229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with APC.
Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAJ305Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CXADR (Leu20~Val229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with Biotin.
Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), Cy3
4-PAJ305Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CXADR (Leu20~Val229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with Cy3.
Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), FITC
4-PAJ305Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CXADR (Leu20~Val229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with FITC.
Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), HRP
4-PAJ305Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CXADR (Leu20~Val229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with HRP.
Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), PE
4-PAJ305Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CXADR (Leu20~Val229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with PE.
Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAJ305Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CXADR (Leu20~Val229)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with APC-Cy7.
Anti-Coxsackie Adenovirus Receptor/CXADR Antibody
PA1852 100ug/vial
EUR 294
Human CXADR/ Coxsackievirus and adenovirus receptor ELISA Kit
E0613Hu 1 Kit
EUR 605
Human CXADR(Coxsackievirus and adenovirus receptor) ELISA Kit
EH1547 96T
EUR 567.6
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P78310
  • Alias: CXADR(Coxsackie virus and adenovirus receptor/coxsackie virus B receptor)/CAR/CVB3 BP/HCAR/HCVADR/CAR10/Coxsackievirus B-adenovirus receptor/CAR4,6/CVB3 binding protein/CVB3-binding protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
Human Coxsackievirus and adenovirus receptor, CXADR ELISA KIT
ELI-04539h 96 Tests
EUR 824
Human Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
abx250834-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Coxsackievirus and adenovirus receptor(CXADR) ELISA kit
CSB-EL006237HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Coxsackievirus and adenovirus receptor (CXADR) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Coxsackievirus and adenovirus receptor(CXADR) ELISA kit
1-CSB-EL006237HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Coxsackievirus and adenovirus receptor(CXADR) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
20-abx001505
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
20-abx009371
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
abx031745-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
abx031745-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
20-abx014400
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
20-abx301167
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
abx232091-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
Cow Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
abx516680-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
abx516682-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Rat Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
abx516683-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.
anti-Coxsackie Adenovirus Receptor
YF-PA11220 50 ug
EUR 363
Description: Mouse polyclonal to Coxsackie Adenovirus Receptor
anti-Coxsackie Adenovirus Receptor
YF-PA11221 100 ug
EUR 403
Description: Rabbit polyclonal to Coxsackie Adenovirus Receptor
Coxsackievirus And Adenovirus Receptor (CXADR) Antibody (HRP)
20-abx303541
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Coxsackievirus And Adenovirus Receptor (CXADR) Antibody (FITC)
20-abx303542
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Coxsackievirus And Adenovirus Receptor (CXADR) Antibody (Biotin)
20-abx303543
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
20-abx151097
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
DLR-CLMP-Hu-48T 48T
EUR 554
  • Should the Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
DLR-CLMP-Hu-96T 96T
EUR 725
  • Should the Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
RDR-CLMP-Hu-48Tests 48 Tests
EUR 589
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
RDR-CLMP-Hu-96Tests 96 Tests
EUR 820
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
RD-CLMP-Hu-48Tests 48 Tests
EUR 563
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
RD-CLMP-Hu-96Tests 96 Tests
EUR 783
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
SEW786Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
SEW786Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
SEW786Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
SEW786Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
4-SEW786Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Coxsackie And Adenovirus Receptor Like Membrane Protein elisa. Alternative names of the recognized antigen: ACAM
  • ASAM
  • Adipocyte Adhesion Molecule
  • Adipocyte-Specific Adhesion Molecule
  • CXADR Like Membrane Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
ELISA kit for Human CLMP (Coxsackie And Adenovirus Receptor Like Membrane Protein)
ELK7178 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-con
  • Show more
Description: A sandwich ELISA kit for detection of Coxsackie And Adenovirus Receptor Like Membrane Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) CLIA Kit
20-abx496287
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Antibody
20-abx130591
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Antibody
20-abx171939
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.
Recombinant Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP)
4-RPW786Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H6B4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 22.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Coxsackie And Adenovirus Receptor Like Membrane Protein expressed in: E.coli
Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Protein
20-abx650838
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human)
4-PAW786Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLMP (Thr19~Ser183)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP)
Human Coxsackie Virus IgM ELISA Kit
abx052809-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.
Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), APC
4-PAW786Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLMP (Thr19~Ser183)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with APC.
Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), Biotinylated
4-PAW786Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLMP (Thr19~Ser183)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with Biotin.
Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), Cy3
4-PAW786Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLMP (Thr19~Ser183)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with Cy3.
Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), FITC
4-PAW786Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLMP (Thr19~Ser183)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with FITC.
Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), HRP
4-PAW786Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLMP (Thr19~Ser183)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with HRP.
Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), PE
4-PAW786Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLMP (Thr19~Ser183)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with PE.
Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), APC-Cy7
4-PAW786Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CLMP (Thr19~Ser183)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with APC-Cy7.
ELISA kit for Human Coxsackievirus and adenovirus receptor
EK3312 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Coxsackievirus and adenovirus receptor in samples from serum, plasma, tissue homogenates and other biological fluids.
Human Coxsackie virus IgG(Cox V-IgG)ELISA Kit
GA-E1759HM-48T 48T
EUR 289
Human Coxsackie virus IgG(Cox V-IgG)ELISA Kit
GA-E1759HM-96T 96T
EUR 466
Human Coxsackie virus IgM(Cox V-IgM)ELISA Kit
GA-E1823HM-48T 48T
EUR 289
Human Coxsackie virus IgM(Cox V-IgM)ELISA Kit
GA-E1823HM-96T 96T
EUR 466
Human Coxsackie virus IgG,Cox V-IgG ELISA Kit
201-12-1743 96 tests
EUR 440
  • This Coxsackie virus IgG ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Coxsackie virus IgM,Cox V-IgM ELISA Kit
201-12-1807 96 tests
EUR 440
  • This Coxsackie virus IgM ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Coxsackie virus IgM(Cox V-IgM)ELISA Kit
QY-E02492 96T
EUR 394
Human Coxsackie virus IgG(Cox V-IgG)ELISA Kit
QY-E02493 96T
EUR 394
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Cxadr/ Rat Cxadr ELISA Kit
ELI-04538r 96 Tests
EUR 886
ELISA kit for Human Coxsackie virus (Cox V) antibody (IgG)
EK0187 96 tests
EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Coxsackie virus (Cox V) antibody (IgG) in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Coxsackie virus (Cox V) antibody (IgM)
EK0188 96 tests
EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Coxsackie virus (Cox V) antibody (IgM) in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human Coxsackie virus IgM (Cox V-IgM)
KTE62276-48T 48T
EUR 332
  • Immunoglobulin M, or IgM for short, is a basic antibody that is present on B cells. It is the primary antibody against A and B antigens on red blood cells. IgM is by far the physically largest antibody in the human circulatory system. It is produced
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Coxsackie virus IgM (Cox V-IgM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Coxsackie virus IgM (Cox V-IgM)
KTE62276-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Immunoglobulin M, or IgM for short, is a basic antibody that is present on B cells. It is the primary antibody against A and B antigens on red blood cells. IgM is by far the physically largest antibody in the human circulatory system. It is produced
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Coxsackie virus IgM (Cox V-IgM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Coxsackie virus IgM (Cox V-IgM)
KTE62276-96T 96T
EUR 539
  • Immunoglobulin M, or IgM for short, is a basic antibody that is present on B cells. It is the primary antibody against A and B antigens on red blood cells. IgM is by far the physically largest antibody in the human circulatory system. It is produced
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Coxsackie virus IgM (Cox V-IgM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Virus Adenovirus (ADV) Protein
abx670001-1ml 1 ml
EUR 620
  • Shipped within 1 week.
Human CXADR ELISA Kit
ELA-E13929h 96 Tests
EUR 824
CXADR ELISA KIT|Human
EF005677 96 Tests
EUR 689
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9
Mouse Cxadr ELISA KIT
ELI-04537m 96 Tests
EUR 865
Bovine CXADR ELISA KIT
ELI-04540b 96 Tests
EUR 928
Human Adenovirus (ADV) ELISA Kit
abx052689-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.
Coxsackie A PCR kit
PCR-H720-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Coxsackie A
Coxsackie A PCR kit
PCR-H720-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Coxsackie A
Coxsackie B PCR kit
PCR-H721-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Coxsackie B
Coxsackie B PCR kit
PCR-H721-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Coxsackie B
Mouse CXADR PicoKine ELISA Kit
EK1725 96 wells
EUR 425
Description: For quantitative detection of mouse CXADR in cell culture supernates, serum and plasma (heparin, EDTA, citrate).
Rat CXADR PicoKine ELISA Kit
EK1726 96 wells
EUR 425
Description: For quantitative detection of rat CXADR in cell culture supernates, serum and plasma (heparin, EDTA, citrate).
Adenovirus IgA ELISA kit
55R-IB79201 96 wells
EUR 316
Description: ELISA kit for the detection of Adenovirus IgA in the research laboratory
Adenovirus IgG ELISA kit
55R-IB79202 96 wells
EUR 330
Description: ELISA kit for the detection of Adenovirus IgG in the research laboratory
Adenovirus IgM ELISA kit
55R-IB79203 96 wells
EUR 319
Description: ELISA kit for the detection of Adenovirus IgM in the research laboratory
Adenovirus IgG ELISA Kit
DEIA309 96T
EUR 650
Description: The Adenovirus IgG Antibody ELISA Test Kit has been designed for the the detection and the quantitative determination of specific IgG antibodies against Adenovirus in serum and plasma.
Adenovirus IgA ELISA Kit
DEIA310 96T
EUR 650
Description: The Adenovirus IgA Antibody ELISA Test Kit has been designed for the the detection and the quantitative determination of specific IgA antibodies against Adenovirus in serum and plasma.
Adenovirus IgM ELISA Kit
DEIA311 96T
EUR 650
Description: The Adenovirus IgM Antibody ELISA Test Kit has been designed forthe the detection and the quantitative determination of specific IgM antibodies against Adenovirus in serum and plasma.
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9
Virus Adenovirus Type 5 (ADV-5) Protein
abx670093-01mg 0.1 mg
EUR 453
  • Shipped within 1 week.
Human CXADR Antibody
32643-05111 150 ug
EUR 261
Human Adenovirus 36 (ADV36) ELISA Kit
abx051985-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.
Coxsackie A RT PCR kit
RTq-H720-100D 100T
EUR 628.5
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie A .
Coxsackie A RT PCR kit
RTq-H720-150D 150T
EUR 701
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie A .
Coxsackie A RT PCR kit
RTq-H720-50D 50T
EUR 532.8
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie A .
Coxsackie B RT PCR kit
RTq-H721-100D 100T
EUR 628.5
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie B .
Coxsackie B RT PCR kit
RTq-H721-150D 150T
EUR 701
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie B .
Coxsackie B RT PCR kit
RTq-H721-50D 50T
EUR 532.8
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Coxsackie B .
Mouse Adenovirus (ADV) ELISA Kit
abx055024-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.
Rat Adenovirus (ADV) ELISA Kit
abx055049-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.
QuickTiter Adenovirus Titer ELISA Kit
VPK-110 2 x 96 assays
EUR 699
Description: Accurate measurement of adenovirus titer is critical for gene delivery. Traditional plaque-forming unit (PFU) assays are long and suffer from high inter-assay variability. The QuickTiter Adenovirus Titer ELISA Kit provides a quick, complete system to functionally titer virus infectivity. The assay recognizes all 41 serotypes of adenovirus, and can be used with any adenovirus system that can amplify in HEK 293 cells.
CXADR siRNA
20-abx901347
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CXADR Protein
20-abx261108
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
CXADR siRNA
20-abx913231
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CXADR siRNA
20-abx913232
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
CXADR antibody
70R-49623 100 ul
EUR 244
Description: Purified Polyclonal CXADR antibody
CXADR antibody
70R-35487 100 ug
EUR 327
Description: Purified Rabbit polyclonal CXADR antibody
CXADR antibody
70R-6982 50 ug
EUR 467
Description: Rabbit polyclonal CXADR antibody raised against the N terminal of CXADR
CXADR Antibody
ABD3973 100 ug
EUR 438
CXADR Antibody
ABD6638 100 ug
EUR 438
CXADR Antibody
34624-100ul 100ul
EUR 252
CXADR Antibody
34624-50ul 50ul
EUR 187
CXADR Antibody
32451-100ul 100ul
EUR 252
CXADR antibody
70R-16680 50 ul
EUR 435
Description: Rabbit polyclonal CXADR antibody
CXADR Antibody
DF6638 200ul
EUR 304
Description: CXADR Antibody detects endogenous levels of total CXADR.
CXADR Antibody
DF3973 200ul
EUR 304
Description: CXADR Antibody detects endogenous levels of total CXADR.
CXADR Antibody
1-CSB-PA001210
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
CXADR Antibody
1-CSB-PA006237GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
CXADR Antibody
1-CSB-PA006237LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
CXADR Antibody
CSB-PA830526-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
CXADR Antibody
CSB-PA830526-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
Adenovirus PCR kit
PCR-H501-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Adenovirus
Adenovirus PCR kit
PCR-H501-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Adenovirus
Adenovirus Purification Kit
K1459-100 100 Preps
EUR 1037
Adenovirus Purification Kit
K1459-20 20 Preps
EUR 606
Human CXADR- like membrane protein, CLMP ELISA KIT
ELI-25612h 96 Tests
EUR 824
Human Adenovirus Antigen(ADV-Ag)ELISA Kit
GA-E1760HM-48T 48T
EUR 289
Human Adenovirus Antigen(ADV-Ag)ELISA Kit
GA-E1760HM-96T 96T
EUR 466
Human Adenovirus IgM(ADV-IgM)ELISA Kit
GA-E1780HM-48T 48T
EUR 289
Human Adenovirus IgM(ADV-IgM)ELISA Kit
GA-E1780HM-96T 96T
EUR 466
Human Adenovirus IgG(ADV-IgG)ELISA Kit
GA-E1784HM-48T 48T
EUR 289
Human Adenovirus IgG(ADV-IgG)ELISA Kit
GA-E1784HM-96T 96T
EUR 466
Human Adenovirus Antigen,ADV-Ag ELISA Kit
201-12-1744 96 tests
EUR 440
  • This Adenovirus Antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Adenovirus IgM,ADV-IgM ELISA Kit
201-12-1764 96 tests
EUR 440
  • This Adenovirus IgM ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Adenovirus IgG,ADV-IgG ELISA Kit
201-12-1768 96 tests
EUR 440
  • This Adenovirus IgG ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Adenovirus (ADV)antibody(IgG)ELISA Kit
CSB-E05005h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human Adenovirus (ADV)antibody (IgG) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Adenovirus (ADV)antibody(IgG)ELISA Kit
1-CSB-E05005h
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human Adenovirus (ADV)antibody(IgG) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human adenovirus (ADV) antibody (IgM) ELISA kit
CSB-E05006h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human adenovirus (ADV) antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human adenovirus (ADV) antibody (IgM) ELISA kit
1-CSB-E05006h
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Human adenovirus (ADV) antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Adenovirus Antigen(ADV-Ag)ELISA Kit
QY-E00882 96T
EUR 361
Human Adenovirus IgM(ADV-IgM)ELISA Kit
QY-E00883 96T
EUR 361
Human Adenovirus IgG(ADV-IgG)ELISA Kit
QY-E00884 96T
EUR 361
Human Immunodeficiency Virus (1+2) Antigen and Antibody ELISA Kit
DEIA066 96T
EUR 502
Description: This HIV 1+2 Ag/Ab ELISA is an enzyme-linked immunosorbent assay (ELISA) intended for qualitative detection of antigens and/or antibodies to Human Immunodeficiency Viruses (HIV) type 1(group M - O) and/or type 2 in human serum or plasma samples. The method is also known as 4th generation ELISA for HIV detection. The kit is intended for screening of blood donors and as an aid in the diagnosis of clinical conditions related to infection with HIV-1 and/or HIV-2 - the etiological agents of the acquired immunodeficiency syndrome (AIDS).
Human CXADR shRNA Plasmid
20-abx951080
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
CXADR Recombinant Protein (Human)
RP008422 100 ug Ask for price
CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9
Pig Reproductive and Respiratory Syndrome Virus Antibody ELISA Kit
abx364909-96tests 96 tests
EUR 543
  • Shipped within 5-10 working days.
Virus Foot and Mouth Disease Virus Non-Structural Protein (FMDV NSP) ELISA Kit
abx055782-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Coxsackie A One-Step PCR kit
Oneq-H720-100D 100T
EUR 747.4
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie A.
Coxsackie A One-Step PCR kit
Oneq-H720-150D 150T
EUR 838.75
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie A.
Coxsackie A One-Step PCR kit
Oneq-H720-50D 50T
EUR 628.5
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie A.
Coxsackie B One-Step PCR kit
Oneq-H721-100D 100T
EUR 747.4
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie B.
Coxsackie B One-Step PCR kit
Oneq-H721-150D 150T
EUR 838.75
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie B.
Coxsackie B One-Step PCR kit
Oneq-H721-50D 50T
EUR 628.5
  • Contact us in order to know the reactivity of the kit.
Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie B.
Mouse Adenovirus antibody (IgG) ELISA Kit
CSB-E13901m-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Mouse Adenovirus antibody (IgG) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Mouse Adenovirus antibody (IgG) ELISA Kit
1-CSB-E13901m
  • EUR 703.00
  • EUR 4843.00
  • EUR 2570.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Qualitative indirect ELISA kit for measuring Mouse Adenovirus antibody (IgG) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Foot and mouth disease virus PCR kit
PCR-V225-48R 50T
EUR 524.4
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Foot and mouth disease virus
Foot and mouth disease virus PCR kit
PCR-V225-96R 100T
EUR 669.4
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Foot and mouth disease virus
ELISA kit for Human Adenovirus (ADV)antibody (IgG)ELISA Kit
EK0129 96 tests
EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenovirus (ADV)antibody (IgG)ELISA Kit in samples from serum, plasma, tissue homogenates and other biological fluids.
ELISA kit for Human adenovirus (ADV) antibody (IgM)
EK0128 96 tests
EUR 830
Description: Enzyme-linked immunosorbent assay kit for quantification of Human adenovirus (ADV) antibody (IgM) in samples from serum, plasma, tissue homogenates and other biological fluids.
Human Adenovirus Antibody IgG (ADV IgG) ELISA Kit
abx052155-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.
Human Adenovirus Antibody IgM (ADV IgM) ELISA Kit
abx052156-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.
Human Adenovirus 36 Antibody (ADV36 Ab) ELISA Kit
abx053094-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.
Human Adenovirus Type 5 (ADV-5) ELISA Kit
abx055308-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.
Human Adenovirus (ADV) IgA (ADV IgA) ELISA Kit
abx364853-96tests 96 tests
EUR 511
  • Shipped within 5-12 working days.
Human Adenovirus (ADV) IgG (ADV IgG) ELISA Kit
abx364854-96tests 96 tests
EUR 511
  • Shipped within 5-12 working days.
Human Adenovirus (ADV) IgM (ADV IgM) ELISA Kit
abx364855-96tests 96 tests
EUR 511
  • Shipped within 5-12 working days.
ELISA kit for Human Adenovirus IgA (ADV-IgA)
KTE62701-48T 48T
EUR 332
  • Adenoviruses (members of the family Adenoviridae) are medium-sized (90?100 nm), nonenveloped (without an outer lipid bilayer) viruses with an icosahedral nucleocapsid containing a double stranded DNA genome. Their name derives from their initial isol
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adenovirus IgA (ADV-IgA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Adenovirus IgA (ADV-IgA)
KTE62701-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Adenoviruses (members of the family Adenoviridae) are medium-sized (90?100 nm), nonenveloped (without an outer lipid bilayer) viruses with an icosahedral nucleocapsid containing a double stranded DNA genome. Their name derives from their initial isol
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adenovirus IgA (ADV-IgA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Adenovirus IgA (ADV-IgA)
KTE62701-96T 96T
EUR 539
  • Adenoviruses (members of the family Adenoviridae) are medium-sized (90?100 nm), nonenveloped (without an outer lipid bilayer) viruses with an icosahedral nucleocapsid containing a double stranded DNA genome. Their name derives from their initial isol
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Adenovirus IgA (ADV-IgA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Adenovirus Mini Purification Kit
K1300-10
EUR 544
Adenovirus Mini Purification Kit
K1300-20
EUR 914
Adenovirus Maxi Purification Kit
K1301-10
EUR 1295
Adenovirus Maxi Purification Kit
K1301-2
EUR 533
Adenovirus Maxi Purification Kit
K1301-4
EUR 860
Falcon adenovirus PCR kit
PCR-V017-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Falcon adenovirus
Falcon adenovirus PCR kit
PCR-V017-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Falcon adenovirus
Fowl Adenovirus PCR kit
PCR-V040-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Fowl Adenovirus
Fowl Adenovirus PCR kit
PCR-V040-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Fowl Adenovirus
Reptil Adenovirus PCR kit
PCR-V308-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Reptil Adenovirus
Reptil Adenovirus PCR kit
PCR-V308-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Reptil Adenovirus
Mouse Adenovirus PCR kit
PCR-V366-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Mouse Adenovirus
Mouse Adenovirus PCR kit
PCR-V366-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Mouse Adenovirus
Porcine adenovirus PCR kit
PCR-V726-48D 50T
EUR 425.8
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Porcine adenovirus
Porcine adenovirus PCR kit
PCR-V726-96D 100T
EUR 521.5
  • Contact us in order to know the reactivity of the kit.
Description: An conventional PCR kit for detection of Porcine adenovirus
Adenovirus RT PCR kit
RTq-H501-100D 100T
EUR 628.5
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Adenovirus .
Adenovirus RT PCR kit
RTq-H501-150D 150T
EUR 701
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Adenovirus .
Adenovirus RT PCR kit
RTq-H501-50D 50T
EUR 532.8
  • Contact us in order to know the reactivity of the kit.
Description: A Real-Time PCR kit for detection of Adenovirus .
ViraBind Adenovirus Miniprep Kit
VPK-099 10 preps
EUR 612
Description: Purification of viruses via cesium chloride ultracentrifugation procedures can be tedious and time-consuming. ViraBind Adenovirus Purification Kits provide a much more efficient system for fast adenoviral purification with high yields. The ViraBind Adenovirus Miniprep Kit uses a special spin column to purify supernatant from a single T75 flask or 10cm dish per prep in about 30 minutes.
QuickTiter Adenovirus Quantitation Kit
VPK-106 20 assays
EUR 711
Description: Quantifying your adenovirus prep prior to infection will help you determine the amount of virus needed to achieve the appropriate MOI (multiplicity of infection) for your target cells. Our QuickTiter Adenovirus Quantitation Kit provides a quick method for measuring the viral nucleic acid content of your adenovirus. This assay may be performed either before or after purification of your virus.
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Monoclonal CXADR Antibody
APG02918G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human CXADR. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC
Polyclonal CXADR Antibody
APG02919G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXADR . This antibody is tested and proven to work in the following applications:
CXADR Conjugated Antibody
C32451 100ul
EUR 397
CXADR cloning plasmid
CSB-CL006237HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1098
  • Sequence: atggcgctcctgctgtgcttcgtgctcctgtgcggagtagtggatttcgccagaagtttgagtatcactactcctgaagagatgattgaaaaagccaaaggggaaactgcctatctgccgtgcaaatttacgcttagtcccgaagaccagggaccgctggacatcgagtggctga
  • Show more
Description: A cloning plasmid for the CXADR gene.
anti- CXADR antibody
FNab02091 100µg
EUR 505.25
  • Immunogen: coxsackie virus and adenovirus receptor
  • Uniprot ID: P78310
  • Gene ID: 1525
  • Research Area: Immunology
Description: Antibody raised against CXADR
CXADR Blocking Peptide
20-abx062498
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
CXADR Polyclonal Antibody
A58698 100 µg
EUR 570.55
Description: The best epigenetics products
CXADR Rabbit pAb
A1822-100ul 100 ul
EUR 308
CXADR Rabbit pAb
A1822-200ul 200 ul
EUR 459
CXADR Rabbit pAb
A1822-20ul 20 ul
EUR 183
CXADR Rabbit pAb
A1822-50ul 50 ul
EUR 223
CXADR Blocking Peptide
33R-4065 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXADR antibody, catalog no. 70R-6982
CXADR Blocking Peptide
DF6638-BP 1mg
EUR 195
CXADR Blocking Peptide
DF3973-BP 1mg
EUR 195
Anti-CXADR antibody
PAab02091 100 ug
EUR 355
pCMV-SPORT6-CXADR
PVT13265 2 ug
EUR 391
Anti-CXADR antibody
STJ23296 100 µl
EUR 277
Description: The protein encoded by this gene is a type I membrane receptor for group B coxsackieviruses and subgroup C adenoviruses. Several transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene are found on chromosomes 15, 18, and 21.
Virus DNA extraction and purification
EP10015 100 Tests
EUR 505
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Cattle and Goat Foot and Mouth Disease Virus Type O Antibody ELISA Kit
abx364926-96tests 96 tests
EUR 637
  • Shipped within 5-10 working days.
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing
Human CXADR Antibody (Biotin Conjugate)
32643-05121 150 ug
EUR 369
CXADR ORF Vector (Human) (pORF)
ORF002808 1.0 ug DNA
EUR 95
Recombinant Human CXADR/CAR Protein
RP00238 10 μg
EUR 155