Human CXADR(Coxsackie Virus And Adenovirus Receptor) ELISA Kit

Human CXADR(Coxsackie Virus And Adenovirus Receptor) ELISA Kit

To Order Contact us: 

    Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
    RD-CXADR-Hu-48Tests 48 Tests
    EUR 521
    Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
    RD-CXADR-Hu-96Tests 96 Tests
    EUR 723
    Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
    20-abx111814
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
    20-abx129234
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
    20-abx327696
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
    abx330911-100ul 100 ul
    EUR 425
    • Shipped within 5-10 working days.
    Coxsackie Virus And Adenovirus Receptor (CXADR) Antibody
    20-abx171940
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Recombinant Coxsackie Virus And Adenovirus Receptor (CXADR)
    4-RPJ305Hu01
    • EUR 512.16
    • EUR 240.00
    • EUR 1645.60
    • EUR 615.20
    • EUR 1130.40
    • EUR 406.00
    • EUR 3964.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P78310
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 27.0kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Coxsackie Virus And Adenovirus Receptor expressed in: E.coli
    Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
    20-abx151211
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
    SEJ305Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • I
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.
    Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
    SEJ305Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • I
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.
    Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
    SEJ305Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • I
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.
    Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
    SEJ305Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie Virus And Adenovirus Receptor (CXADR) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • I
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in Tissue homogenates, cell lysates and other biological fluids.
    Human Coxsackie Virus And Adenovirus Receptor (CXADR) ELISA Kit
    4-SEJ305Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Coxsackie Virus And Adenovirus Receptor elisa. Alternative names of the recognized antigen: CAR
    • HCAR
    • HCVADR
    • CVB3-binding protein
    • Coxsackievirus B-adenovirus receptor
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Coxsackie Virus And Adenovirus Receptor (CXADR) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Human Coxsackie Virus And Adenovirus Receptor (CXADR) Protein
    20-abx168282
    • EUR 718.00
    • EUR 286.00
    • EUR 2221.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Human Coxsackie Virus And Adenovirus Receptor (CXADR) CLIA Kit
    20-abx495676
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human CXADR (Coxsackie Virus And Adenovirus Receptor)
    ELK4785 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Coxsackie Virus And Adenovirus Receptor (CXADR). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibod
    • Show more
    Description: A sandwich ELISA kit for detection of Coxsackie Virus And Adenovirus Receptor from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    CXADR Coxsackie Virus And Adenovirus Receptor Human Recombinant Protein
    PROTP78310 Regular: 20ug
    EUR 317
    Description: CXADR Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 241 amino acids (20-237) and having a molecular mass of 26.0kDa.;CXADR is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
    Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat)
    4-PAJ305Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CXADR (Leu20~Val229)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR)
    Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), APC
    4-PAJ305Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CXADR (Leu20~Val229)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with APC.
    Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), Biotinylated
    4-PAJ305Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CXADR (Leu20~Val229)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with Biotin.
    Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), Cy3
    4-PAJ305Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CXADR (Leu20~Val229)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with Cy3.
    Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), FITC
    4-PAJ305Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CXADR (Leu20~Val229)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with FITC.
    Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), HRP
    4-PAJ305Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CXADR (Leu20~Val229)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with HRP.
    Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), PE
    4-PAJ305Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CXADR (Leu20~Val229)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with PE.
    Coxsackie Virus And Adenovirus Receptor (CXADR) Polyclonal Antibody (Human, Rat), APC-Cy7
    4-PAJ305Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CXADR (Leu20~Val229)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human, Rat Coxsackie Virus And Adenovirus Receptor (CXADR). This antibody is labeled with APC-Cy7.
    Anti-Coxsackie Adenovirus Receptor/CXADR Antibody
    PA1852 100ug/vial
    EUR 294
    Human CXADR/ Coxsackievirus and adenovirus receptor ELISA Kit
    E0613Hu 1 Kit
    EUR 605
    Human CXADR(Coxsackievirus and adenovirus receptor) ELISA Kit
    EH1547 96T
    EUR 567.6
    • Detection range: 78-5000 pg/ml
    • Uniprot ID: P78310
    • Alias: CXADR(Coxsackie virus and adenovirus receptor/coxsackie virus B receptor)/CAR/CVB3 BP/HCAR/HCVADR/CAR10/Coxsackievirus B-adenovirus receptor/CAR4,6/CVB3 binding protein/CVB3-binding protein
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml
    Human Coxsackievirus and adenovirus receptor, CXADR ELISA KIT
    ELI-04539h 96 Tests
    EUR 824
    Human Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
    abx250834-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Coxsackievirus and adenovirus receptor(CXADR) ELISA kit
    CSB-EL006237HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Coxsackievirus and adenovirus receptor (CXADR) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Coxsackievirus and adenovirus receptor(CXADR) ELISA kit
    1-CSB-EL006237HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Coxsackievirus and adenovirus receptor(CXADR) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
    20-abx001505
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
    20-abx009371
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
    abx031745-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
    abx031745-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
    20-abx014400
    • EUR 314.00
    • EUR 98.00
    • EUR 398.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 200 ug
    • 300 µg
    • Shipped within 5-10 working days.
    Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
    20-abx301167
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Coxsackievirus And Adenovirus Receptor (CXADR) Antibody
    abx232091-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    Cow Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
    abx516680-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Mouse Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
    abx516682-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Rat Coxsackievirus and Adenovirus Receptor (CXADR) ELISA Kit
    abx516683-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.
    anti-Coxsackie Adenovirus Receptor
    YF-PA11220 50 ug
    EUR 363
    Description: Mouse polyclonal to Coxsackie Adenovirus Receptor
    anti-Coxsackie Adenovirus Receptor
    YF-PA11221 100 ug
    EUR 403
    Description: Rabbit polyclonal to Coxsackie Adenovirus Receptor
    Coxsackievirus And Adenovirus Receptor (CXADR) Antibody (HRP)
    20-abx303541
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Coxsackievirus And Adenovirus Receptor (CXADR) Antibody (FITC)
    20-abx303542
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Coxsackievirus And Adenovirus Receptor (CXADR) Antibody (Biotin)
    20-abx303543
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    20-abx151097
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    DLR-CLMP-Hu-48T 48T
    EUR 554
    • Should the Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    DLR-CLMP-Hu-96T 96T
    EUR 725
    • Should the Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    RDR-CLMP-Hu-48Tests 48 Tests
    EUR 589
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    RDR-CLMP-Hu-96Tests 96 Tests
    EUR 820
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    RD-CLMP-Hu-48Tests 48 Tests
    EUR 563
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    RD-CLMP-Hu-96Tests 96 Tests
    EUR 783
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    SEW786Hu-10x96wellstestplate 10x96-wells test plate
    EUR 5189.65
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    SEW786Hu-1x48wellstestplate 1x48-wells test plate
    EUR 515.03
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    SEW786Hu-1x96wellstestplate 1x96-wells test plate
    EUR 692.9
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    SEW786Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2818.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in serum, plasma, tissue homogenates and other biological fluids.
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) ELISA Kit
    4-SEW786Hu
    • EUR 5240.00
    • EUR 2769.00
    • EUR 693.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Coxsackie And Adenovirus Receptor Like Membrane Protein elisa. Alternative names of the recognized antigen: ACAM
    • ASAM
    • Adipocyte Adhesion Molecule
    • Adipocyte-Specific Adhesion Molecule
    • CXADR Like Membrane Protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    ELISA kit for Human CLMP (Coxsackie And Adenovirus Receptor Like Membrane Protein)
    ELK7178 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-con
    • Show more
    Description: A sandwich ELISA kit for detection of Coxsackie And Adenovirus Receptor Like Membrane Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Antibody
    20-abx130591
    • EUR 453.00
    • EUR 133.00
    • EUR 1316.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Antibody
    20-abx171939
    • EUR 926.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Recombinant Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP)
    4-RPW786Hu01
    • EUR 494.24
    • EUR 235.00
    • EUR 1578.40
    • EUR 592.80
    • EUR 1085.60
    • EUR 394.00
    • EUR 3796.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9H6B4
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 22.5kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Coxsackie And Adenovirus Receptor Like Membrane Protein expressed in: E.coli
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) CLIA Kit
    20-abx496287
    • EUR 8569.00
    • EUR 4560.00
    • EUR 1052.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Protein
    20-abx650838
    • EUR 690.00
    • EUR 286.00
    • EUR 2124.00
    • EUR 815.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human)
    4-PAW786Hu01
    • EUR 262.00
    • EUR 2747.00
    • EUR 679.00
    • EUR 331.00
    • EUR 220.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CLMP (Thr19~Ser183)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP)
    Human Coxsackie Virus IgM ELISA Kit
    abx052809-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.
    Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), APC
    4-PAW786Hu01-APC
    • EUR 368.00
    • EUR 3599.00
    • EUR 993.00
    • EUR 472.00
    • EUR 229.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CLMP (Thr19~Ser183)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with APC.
    Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), Biotinylated
    4-PAW786Hu01-Biotin
    • EUR 328.00
    • EUR 2697.00
    • EUR 786.00
    • EUR 404.00
    • EUR 226.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CLMP (Thr19~Ser183)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with Biotin.
    Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), Cy3
    4-PAW786Hu01-Cy3
    • EUR 449.00
    • EUR 4757.00
    • EUR 1283.00
    • EUR 588.00
    • EUR 264.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CLMP (Thr19~Ser183)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with Cy3.
    Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), FITC
    4-PAW786Hu01-FITC
    • EUR 314.00
    • EUR 2899.00
    • EUR 814.00
    • EUR 397.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CLMP (Thr19~Ser183)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with FITC.
    Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), HRP
    4-PAW786Hu01-HRP
    • EUR 335.00
    • EUR 3135.00
    • EUR 877.00
    • EUR 426.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CLMP (Thr19~Ser183)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with HRP.
    Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), PE
    4-PAW786Hu01-PE
    • EUR 314.00
    • EUR 2899.00
    • EUR 814.00
    • EUR 397.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CLMP (Thr19~Ser183)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with PE.
    Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP) Polyclonal Antibody (Human), APC-Cy7
    4-PAW786Hu01-APC-Cy7
    • EUR 616.00
    • EUR 7078.00
    • EUR 1867.00
    • EUR 824.00
    • EUR 338.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CLMP (Thr19~Ser183)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Coxsackie And Adenovirus Receptor Like Membrane Protein (CLMP). This antibody is labeled with APC-Cy7.
    ELISA kit for Human Coxsackievirus and adenovirus receptor
    EK3312 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Coxsackievirus and adenovirus receptor in samples from serum, plasma, tissue homogenates and other biological fluids.
    Human Coxsackie virus IgG(Cox V-IgG)ELISA Kit
    GA-E1759HM-48T 48T
    EUR 289
    Human Coxsackie virus IgG(Cox V-IgG)ELISA Kit
    GA-E1759HM-96T 96T
    EUR 466
    Human Coxsackie virus IgM(Cox V-IgM)ELISA Kit
    GA-E1823HM-48T 48T
    EUR 289
    Human Coxsackie virus IgM(Cox V-IgM)ELISA Kit
    GA-E1823HM-96T 96T
    EUR 466
    Human Coxsackie virus IgG,Cox V-IgG ELISA Kit
    201-12-1743 96 tests
    EUR 440
    • This Coxsackie virus IgG ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Coxsackie virus IgM,Cox V-IgM ELISA Kit
    201-12-1807 96 tests
    EUR 440
    • This Coxsackie virus IgM ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Coxsackie virus IgM(Cox V-IgM)ELISA Kit
    QY-E02492 96T
    EUR 394
    Human Coxsackie virus IgG(Cox V-IgG)ELISA Kit
    QY-E02493 96T
    EUR 394
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Cxadr/ Rat Cxadr ELISA Kit
    ELI-04538r 96 Tests
    EUR 886
    Virus Adenovirus (ADV) Protein
    abx670001-1ml 1 ml
    EUR 620
    • Shipped within 1 week.
    ELISA kit for Human Coxsackie virus (Cox V) antibody (IgG)
    EK0187 96 tests
    EUR 830
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Coxsackie virus (Cox V) antibody (IgG) in samples from serum, plasma, tissue homogenates and other biological fluids.
    ELISA kit for Human Coxsackie virus (Cox V) antibody (IgM)
    EK0188 96 tests
    EUR 830
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Coxsackie virus (Cox V) antibody (IgM) in samples from serum, plasma, tissue homogenates and other biological fluids.
    ELISA kit for Human Coxsackie virus IgM (Cox V-IgM)
    KTE62276-48T 48T
    EUR 332
    • Immunoglobulin M, or IgM for short, is a basic antibody that is present on B cells. It is the primary antibody against A and B antigens on red blood cells. IgM is by far the physically largest antibody in the human circulatory system. It is produced
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Coxsackie virus IgM (Cox V-IgM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Coxsackie virus IgM (Cox V-IgM)
    KTE62276-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Immunoglobulin M, or IgM for short, is a basic antibody that is present on B cells. It is the primary antibody against A and B antigens on red blood cells. IgM is by far the physically largest antibody in the human circulatory system. It is produced
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Coxsackie virus IgM (Cox V-IgM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Coxsackie virus IgM (Cox V-IgM)
    KTE62276-96T 96T
    EUR 539
    • Immunoglobulin M, or IgM for short, is a basic antibody that is present on B cells. It is the primary antibody against A and B antigens on red blood cells. IgM is by far the physically largest antibody in the human circulatory system. It is produced
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Coxsackie virus IgM (Cox V-IgM) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Human CXADR ELISA Kit
    ELA-E13929h 96 Tests
    EUR 824
    CXADR ELISA KIT|Human
    EF005677 96 Tests
    EUR 689
    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9
    CXADR ELISA Kit (Human) (OKCD09183)
    OKCD09183 96 Wells
    EUR 975
    Description: Description of target: The protein encoded by this gene is a type I membrane receptor for group B coxsackieviruses and subgroup C adenoviruses. Several transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene are found on chromosomes 15, 18, and 21.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL
    CXADR ELISA Kit (Human) (OKEH02324)
    OKEH02324 96 Wells
    EUR 662
    Description: Description of target: The protein encoded by this gene is a type I membrane receptor for group B coxsackieviruses and subgroup C adenoviruses. Several transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene are found on chromosomes 15, 18, and 21.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL
    Mouse Cxadr ELISA KIT
    ELI-04537m 96 Tests
    EUR 865
    Bovine CXADR ELISA KIT
    ELI-04540b 96 Tests
    EUR 928
    Human Adenovirus (ADV) ELISA Kit
    abx052689-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.
    Coxsackie A PCR kit
    PCR-H720-48D 50T
    EUR 425.8
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Coxsackie A
    Coxsackie A PCR kit
    PCR-H720-96D 100T
    EUR 521.5
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Coxsackie A
    Coxsackie B PCR kit
    PCR-H721-48D 50T
    EUR 425.8
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Coxsackie B
    Coxsackie B PCR kit
    PCR-H721-96D 100T
    EUR 521.5
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Coxsackie B
    Virus Adenovirus Type 5 (ADV-5) Protein
    abx670093-01mg 0.1 mg
    EUR 453
    • Shipped within 1 week.
    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9
    Adenovirus IgA ELISA kit
    55R-IB79201 96 wells
    EUR 316
    Description: ELISA kit for the detection of Adenovirus IgA in the research laboratory
    Adenovirus IgG ELISA kit
    55R-IB79202 96 wells
    EUR 330
    Description: ELISA kit for the detection of Adenovirus IgG in the research laboratory
    Adenovirus IgM ELISA kit
    55R-IB79203 96 wells
    EUR 319
    Description: ELISA kit for the detection of Adenovirus IgM in the research laboratory
    Adenovirus IgG ELISA Kit
    DEIA309 96T
    EUR 650
    Description: The Adenovirus IgG Antibody ELISA Test Kit has been designed for the the detection and the quantitative determination of specific IgG antibodies against Adenovirus in serum and plasma.
    Adenovirus IgA ELISA Kit
    DEIA310 96T
    EUR 650
    Description: The Adenovirus IgA Antibody ELISA Test Kit has been designed for the the detection and the quantitative determination of specific IgA antibodies against Adenovirus in serum and plasma.
    Adenovirus IgM ELISA Kit
    DEIA311 96T
    EUR 650
    Description: The Adenovirus IgM Antibody ELISA Test Kit has been designed forthe the detection and the quantitative determination of specific IgM antibodies against Adenovirus in serum and plasma.
    Mouse CXADR PicoKine ELISA Kit
    EK1725 96 wells
    EUR 425
    Description: For quantitative detection of mouse CXADR in cell culture supernates, serum and plasma (heparin, EDTA, citrate).
    Rat CXADR PicoKine ELISA Kit
    EK1726 96 wells
    EUR 425
    Description: For quantitative detection of rat CXADR in cell culture supernates, serum and plasma (heparin, EDTA, citrate).
    Cxadr ELISA Kit (Mouse) (OKBB01201)
    OKBB01201 96 Wells
    EUR 505
    Description: Description of target: CXADR(Coxsackie virus and adenovirus receptor) is a protein that in humans is encoded by the CXADR gene, also known as CAR,CVB3-binding protein, this gene is mapped to 16; 16 C3.1. Coxsackievirus B-adenovirus receptor. The CAR cDNA encodes a predicted 365-amino acid polypeptide that contains a single transmembrane domain and is a member of the immunoglobulin superfamily. By Northern blot analysis, they detected highest expression of 1.4-kb and 6-kb CXADR transcripts in pancreas, brain, heart, small intestine, testis, and prostate, lower expression in liver and lung, and no expression in kidney, placenta, peripheral blood leukocytes, thymus, and spleen. In comparison, mouse Cxadr showed highest expression in liver, and lower levels in kidney, heart, lung, and brain. The protein encoded by this gene is a type I membrane receptor for group B coxsackie viruses and subgroup C adenoviruses. Pseudogenes of this gene are found on chromosomes 15, 18, and 21. CAR is strongly expressed in the developing central nervous system. It functions as a homophilic and also as a heterophilic cell adhesion molecule through its interactions with extracellular matrix glycoproteins , such as: fibronectin, agrin, laminin-1 and tenascin-R.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
    Cxadr ELISA Kit (Rat) (OKBB01202)
    OKBB01202 96 Wells
    EUR 505
    Description: Description of target: CXADR(Coxsackie virus and adenovirus receptor) is a protein that in humans is encoded by the CXADR gene, also known as CAR,CVB3-binding protein, this gene is mapped to 11q11. Coxsackievirus B-adenovirus receptor. The CAR cDNA encodes a predicted 365-amino acid polypeptide that contains a single transmembrane domain and is a member of the immunoglobulin superfamily. By Northern blot analysis, they detected highest expression of 1.4-kb and 6-kb CXADR transcripts in pancreas, brain, heart, small intestine, testis, and prostate, lower expression in liver and lung, and no expression in kidney, placenta, peripheral blood leukocytes, thymus, and spleen. In comparison, mouse Cxadr showed highest expression in liver, and lower levels in kidney, heart, lung, and brain. The protein encoded by this gene is a type I membrane receptor for group B coxsackie viruses and subgroup C adenoviruses. Pseudogenes of this gene are found on chromosomes 15, 18, and 21. CAR is strongly expressed in the developing central nervous system. It functions as a homophilic and also as a heterophilic cell adhesion molecule through its interactions with extracellular matrix glycoproteins , such as: fibronectin, agrin, laminin-1 and tenascin-R.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml
    CXADR ELISA Kit (Mouse) (OKEH05526)
    OKEH05526 96 Wells
    EUR 662
    Description: Description of target: Component of the epithelial apical junction complex that may function as a homophilic cell adhesion molecule and is essential for tight junction integrity. Also involved in transepithelial migration of leukocytes through adhesive interactions with JAML a transmembrane protein of the plasma membrane of leukocytes. The interaction between both receptors also mediates the activation of gamma-delta T-cells, a subpopulation of T-cells residing in epithelia and involved in tissue homeostasis and repair. Upon epithelial CXADR-binding, JAML induces downstream cell signaling events in gamma-delta T-cells through PI3-kinase and MAP kinases. It results in proliferation and production of cytokines and growth factors by T-cells that in turn stimulate epithelial tissues repair.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39 pg/mL
    CXADR ELISA Kit (Bovine) (OKEH07971)
    OKEH07971 96 Wells
    EUR 1092
    Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
    Human CXADR Antibody
    32643-05111 150 ug
    EUR 261
    Human Adenovirus 36 (ADV36) ELISA Kit
    abx051985-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.
    Coxsackie A RT PCR kit
    RTq-H720-100D 100T
    EUR 628.5
    • Contact us in order to know the reactivity of the kit.
    Description: A Real-Time PCR kit for detection of Coxsackie A .
    Coxsackie A RT PCR kit
    RTq-H720-150D 150T
    EUR 701
    • Contact us in order to know the reactivity of the kit.
    Description: A Real-Time PCR kit for detection of Coxsackie A .
    Coxsackie A RT PCR kit
    RTq-H720-50D 50T
    EUR 532.8
    • Contact us in order to know the reactivity of the kit.
    Description: A Real-Time PCR kit for detection of Coxsackie A .
    Coxsackie B RT PCR kit
    RTq-H721-100D 100T
    EUR 628.5
    • Contact us in order to know the reactivity of the kit.
    Description: A Real-Time PCR kit for detection of Coxsackie B .
    Coxsackie B RT PCR kit
    RTq-H721-150D 150T
    EUR 701
    • Contact us in order to know the reactivity of the kit.
    Description: A Real-Time PCR kit for detection of Coxsackie B .
    Coxsackie B RT PCR kit
    RTq-H721-50D 50T
    EUR 532.8
    • Contact us in order to know the reactivity of the kit.
    Description: A Real-Time PCR kit for detection of Coxsackie B .
    CXADR siRNA
    20-abx901347
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CXADR Protein
    20-abx261108
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    CXADR siRNA
    20-abx913231
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CXADR siRNA
    20-abx913232
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    CXADR antibody
    70R-49623 100 ul
    EUR 244
    Description: Purified Polyclonal CXADR antibody
    CXADR antibody
    70R-35487 100 ug
    EUR 327
    Description: Purified Rabbit polyclonal CXADR antibody
    CXADR antibody
    70R-6982 50 ug
    EUR 467
    Description: Rabbit polyclonal CXADR antibody raised against the N terminal of CXADR
    CXADR Antibody
    ABD3973 100 ug
    EUR 438
    CXADR Antibody
    ABD6638 100 ug
    EUR 438
    CXADR Antibody
    34624-100ul 100ul
    EUR 252
    CXADR Antibody
    34624-50ul 50ul
    EUR 187
    CXADR Antibody
    32451-100ul 100ul
    EUR 252
    CXADR antibody
    70R-16680 50 ul
    EUR 435
    Description: Rabbit polyclonal CXADR antibody
    CXADR Antibody
    DF6638 200ul
    EUR 304
    Description: CXADR Antibody detects endogenous levels of total CXADR.
    CXADR Antibody
    DF3973 200ul
    EUR 304
    Description: CXADR Antibody detects endogenous levels of total CXADR.
    CXADR Antibody
    1-CSB-PA001210
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
    CXADR Antibody
    1-CSB-PA006237GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    CXADR Antibody
    1-CSB-PA006237LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    CXADR Antibody
    CSB-PA830526-
    EUR 335
    • Form: liquid
    • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
    • Show more
    Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
    CXADR Antibody
    CSB-PA830526-100ul 100ul
    EUR 316
    • Form: liquid
    • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
    • Show more
    Description: A polyclonal antibody against CXADR. Recognizes CXADR from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
    Mouse Adenovirus (ADV) ELISA Kit
    abx055024-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.
    Rat Adenovirus (ADV) ELISA Kit
    abx055049-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.
    QuickTiter Adenovirus Titer ELISA Kit
    VPK-110 2 x 96 assays
    EUR 699
    Description: Accurate measurement of adenovirus titer is critical for gene delivery. Traditional plaque-forming unit (PFU) assays are long and suffer from high inter-assay variability. The QuickTiter Adenovirus Titer ELISA Kit provides a quick, complete system to functionally titer virus infectivity. The assay recognizes all 41 serotypes of adenovirus, and can be used with any adenovirus system that can amplify in HEK 293 cells.
    Adenovirus PCR kit
    PCR-H501-48D 50T
    EUR 425.8
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Adenovirus
    Adenovirus PCR kit
    PCR-H501-96D 100T
    EUR 521.5
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Adenovirus
    Adenovirus Purification Kit
    K1459-100 100 Preps
    EUR 1037
    Adenovirus Purification Kit
    K1459-20 20 Preps
    EUR 606
    Human CXADR- like membrane protein, CLMP ELISA KIT
    ELI-25612h 96 Tests
    EUR 824
    Human Immunodeficiency Virus (1+2) Antigen and Antibody ELISA Kit
    DEIA066 96T
    EUR 502
    Description: This HIV 1+2 Ag/Ab ELISA is an enzyme-linked immunosorbent assay (ELISA) intended for qualitative detection of antigens and/or antibodies to Human Immunodeficiency Viruses (HIV) type 1(group M - O) and/or type 2 in human serum or plasma samples. The method is also known as 4th generation ELISA for HIV detection. The kit is intended for screening of blood donors and as an aid in the diagnosis of clinical conditions related to infection with HIV-1 and/or HIV-2 - the etiological agents of the acquired immunodeficiency syndrome (AIDS).
    Human Adenovirus Antigen(ADV-Ag)ELISA Kit
    GA-E1760HM-48T 48T
    EUR 289
    Human Adenovirus Antigen(ADV-Ag)ELISA Kit
    GA-E1760HM-96T 96T
    EUR 466
    Human Adenovirus IgM(ADV-IgM)ELISA Kit
    GA-E1780HM-48T 48T
    EUR 289
    Human Adenovirus IgM(ADV-IgM)ELISA Kit
    GA-E1780HM-96T 96T
    EUR 466
    Human Adenovirus IgG(ADV-IgG)ELISA Kit
    GA-E1784HM-48T 48T
    EUR 289
    Human Adenovirus IgG(ADV-IgG)ELISA Kit
    GA-E1784HM-96T 96T
    EUR 466
    Human Adenovirus Antigen,ADV-Ag ELISA Kit
    201-12-1744 96 tests
    EUR 440
    • This Adenovirus Antigen ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Adenovirus IgM,ADV-IgM ELISA Kit
    201-12-1764 96 tests
    EUR 440
    • This Adenovirus IgM ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Adenovirus IgG,ADV-IgG ELISA Kit
    201-12-1768 96 tests
    EUR 440
    • This Adenovirus IgG ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
    Human Adenovirus (ADV)antibody(IgG)ELISA Kit
    CSB-E05005h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Qualitative indirect ELISA kit for measuring Human Adenovirus (ADV)antibody (IgG) in samples from serum. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Adenovirus (ADV)antibody(IgG)ELISA Kit
    1-CSB-E05005h
    • EUR 703.00
    • EUR 4843.00
    • EUR 2570.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Qualitative indirect ELISA kit for measuring Human Adenovirus (ADV)antibody(IgG) in samples from serum. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human adenovirus (ADV) antibody (IgM) ELISA kit
    CSB-E05006h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Qualitative indirect ELISA kit for measuring Human adenovirus (ADV) antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human adenovirus (ADV) antibody (IgM) ELISA kit
    1-CSB-E05006h
    • EUR 703.00
    • EUR 4843.00
    • EUR 2570.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Qualitative indirect ELISA kit for measuring Human adenovirus (ADV) antibody (IgM) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Adenovirus Antigen(ADV-Ag)ELISA Kit
    QY-E00882 96T
    EUR 361
    Human Adenovirus IgM(ADV-IgM)ELISA Kit
    QY-E00883 96T
    EUR 361
    Human Adenovirus IgG(ADV-IgG)ELISA Kit
    QY-E00884 96T
    EUR 361
    Human CXADR shRNA Plasmid
    20-abx951080
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    CXADR Recombinant Protein (Human)
    RP008422 100 ug Ask for price
    CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
    CASCL9-100A-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Pig Reproductive and Respiratory Syndrome Virus Antibody ELISA Kit
    abx364909-96tests 96 tests
    EUR 543
    • Shipped within 5-10 working days.
    Virus Foot and Mouth Disease Virus Non-Structural Protein (FMDV NSP) ELISA Kit
    abx055782-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Coxsackie A One-Step PCR kit
    Oneq-H720-100D 100T
    EUR 747.4
    • Contact us in order to know the reactivity of the kit.
    Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie A.
    Coxsackie A One-Step PCR kit
    Oneq-H720-150D 150T
    EUR 838.75
    • Contact us in order to know the reactivity of the kit.
    Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie A.
    Coxsackie A One-Step PCR kit
    Oneq-H720-50D 50T
    EUR 628.5
    • Contact us in order to know the reactivity of the kit.
    Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie A.
    Coxsackie B One-Step PCR kit
    Oneq-H721-100D 100T
    EUR 747.4
    • Contact us in order to know the reactivity of the kit.
    Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie B.
    Coxsackie B One-Step PCR kit
    Oneq-H721-150D 150T
    EUR 838.75
    • Contact us in order to know the reactivity of the kit.
    Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie B.
    Coxsackie B One-Step PCR kit
    Oneq-H721-50D 50T
    EUR 628.5
    • Contact us in order to know the reactivity of the kit.
    Description: Real Time PCR Kit is a screening assay for a rapid and accurate detection of Coxsackie B.
    Mouse Adenovirus antibody (IgG) ELISA Kit
    CSB-E13901m-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Qualitative indirect ELISA kit for measuring Mouse Adenovirus antibody (IgG) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Mouse Adenovirus antibody (IgG) ELISA Kit
    1-CSB-E13901m
    • EUR 703.00
    • EUR 4843.00
    • EUR 2570.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Qualitative indirect ELISA kit for measuring Mouse Adenovirus antibody (IgG) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Foot and mouth disease virus PCR kit
    PCR-V225-48R 50T
    EUR 524.4
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Foot and mouth disease virus
    Foot and mouth disease virus PCR kit
    PCR-V225-96R 100T
    EUR 669.4
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Foot and mouth disease virus
    Virus DNA extraction and purification
    EP10015 100 Tests
    EUR 505
    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing
    Adenovirus Mini Purification Kit
    K1300-10
    EUR 544
    Adenovirus Mini Purification Kit
    K1300-20
    EUR 914
    Adenovirus Maxi Purification Kit
    K1301-10
    EUR 1295
    Adenovirus Maxi Purification Kit
    K1301-2
    EUR 533
    Adenovirus Maxi Purification Kit
    K1301-4
    EUR 860
    Falcon adenovirus PCR kit
    PCR-V017-48D 50T
    EUR 425.8
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Falcon adenovirus
    Falcon adenovirus PCR kit
    PCR-V017-96D 100T
    EUR 521.5
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Falcon adenovirus
    Fowl Adenovirus PCR kit
    PCR-V040-48D 50T
    EUR 425.8
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Fowl Adenovirus
    Fowl Adenovirus PCR kit
    PCR-V040-96D 100T
    EUR 521.5
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Fowl Adenovirus
    Reptil Adenovirus PCR kit
    PCR-V308-48D 50T
    EUR 425.8
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Reptil Adenovirus
    Reptil Adenovirus PCR kit
    PCR-V308-96D 100T
    EUR 521.5
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Reptil Adenovirus
    Mouse Adenovirus PCR kit
    PCR-V366-48D 50T
    EUR 425.8
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Mouse Adenovirus
    Mouse Adenovirus PCR kit
    PCR-V366-96D 100T
    EUR 521.5
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Mouse Adenovirus
    Porcine adenovirus PCR kit
    PCR-V726-48D 50T
    EUR 425.8
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Porcine adenovirus
    Porcine adenovirus PCR kit
    PCR-V726-96D 100T
    EUR 521.5
    • Contact us in order to know the reactivity of the kit.
    Description: An conventional PCR kit for detection of Porcine adenovirus
    Adenovirus RT PCR kit
    RTq-H501-100D 100T
    EUR 628.5
    • Contact us in order to know the reactivity of the kit.
    Description: A Real-Time PCR kit for detection of Adenovirus .
    Adenovirus RT PCR kit
    RTq-H501-150D 150T
    EUR 701
    • Contact us in order to know the reactivity of the kit.
    Description: A Real-Time PCR kit for detection of Adenovirus .
    Adenovirus RT PCR kit
    RTq-H501-50D 50T
    EUR 532.8
    • Contact us in order to know the reactivity of the kit.
    Description: A Real-Time PCR kit for detection of Adenovirus .
    ViraBind Adenovirus Miniprep Kit
    VPK-099 10 preps
    EUR 612
    Description: Purification of viruses via cesium chloride ultracentrifugation procedures can be tedious and time-consuming. ViraBind Adenovirus Purification Kits provide a much more efficient system for fast adenoviral purification with high yields. The ViraBind Adenovirus Miniprep Kit uses a special spin column to purify supernatant from a single T75 flask or 10cm dish per prep in about 30 minutes.
    QuickTiter Adenovirus Quantitation Kit
    VPK-106 20 assays
    EUR 711
    Description: Quantifying your adenovirus prep prior to infection will help you determine the amount of virus needed to achieve the appropriate MOI (multiplicity of infection) for your target cells. Our QuickTiter Adenovirus Quantitation Kit provides a quick method for measuring the viral nucleic acid content of your adenovirus. This assay may be performed either before or after purification of your virus.
    ELISA kit for Human adenovirus (ADV) antibody (IgM)
    EK0128 96 tests
    EUR 830
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human adenovirus (ADV) antibody (IgM) in samples from serum, plasma, tissue homogenates and other biological fluids.
    Human Adenovirus Antibody IgG (ADV IgG) ELISA Kit
    abx052155-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.
    Human Adenovirus Antibody IgM (ADV IgM) ELISA Kit
    abx052156-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.
    Human Adenovirus 36 Antibody (ADV36 Ab) ELISA Kit
    abx053094-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.
    Human Adenovirus Type 5 (ADV-5) ELISA Kit
    abx055308-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.
    Human Adenovirus (ADV) IgA (ADV IgA) ELISA Kit
    abx364853-96tests 96 tests
    EUR 511
    • Shipped within 5-12 working days.
    Human Adenovirus (ADV) IgG (ADV IgG) ELISA Kit
    abx364854-96tests 96 tests
    EUR 511
    • Shipped within 5-12 working days.
    Human Adenovirus (ADV) IgM (ADV IgM) ELISA Kit
    abx364855-96tests 96 tests
    EUR 511
    • Shipped within 5-12 working days.
    ELISA kit for Human Adenovirus IgA (ADV-IgA)
    KTE62701-48T 48T
    EUR 332
    • Adenoviruses (members of the family Adenoviridae) are medium-sized (90?100 nm), nonenveloped (without an outer lipid bilayer) viruses with an icosahedral nucleocapsid containing a double stranded DNA genome. Their name derives from their initial isol
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Adenovirus IgA (ADV-IgA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Adenovirus IgA (ADV-IgA)
    KTE62701-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Adenoviruses (members of the family Adenoviridae) are medium-sized (90?100 nm), nonenveloped (without an outer lipid bilayer) viruses with an icosahedral nucleocapsid containing a double stranded DNA genome. Their name derives from their initial isol
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Adenovirus IgA (ADV-IgA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Adenovirus IgA (ADV-IgA)
    KTE62701-96T 96T
    EUR 539
    • Adenoviruses (members of the family Adenoviridae) are medium-sized (90?100 nm), nonenveloped (without an outer lipid bilayer) viruses with an icosahedral nucleocapsid containing a double stranded DNA genome. Their name derives from their initial isol
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Adenovirus IgA (ADV-IgA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Adenovirus (ADV)antibody (IgG)ELISA Kit
    EK0129 96 tests
    EUR 830
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Adenovirus (ADV)antibody (IgG)ELISA Kit in samples from serum, plasma, tissue homogenates and other biological fluids.
    Monoclonal CXADR Antibody
    APG02918G 0.05mg
    EUR 484
    Description: A Monoclonal antibody against Human CXADR. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC
    Polyclonal CXADR Antibody
    APG02919G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CXADR . This antibody is tested and proven to work in the following applications:
    CXADR Conjugated Antibody
    C32451 100ul
    EUR 397
    CXADR cloning plasmid
    CSB-CL006237HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1098
    • Sequence: atggcgctcctgctgtgcttcgtgctcctgtgcggagtagtggatttcgccagaagtttgagtatcactactcctgaagagatgattgaaaaagccaaaggggaaactgcctatctgccgtgcaaatttacgcttagtcccgaagaccagggaccgctggacatcgagtggctga
    • Show more
    Description: A cloning plasmid for the CXADR gene.
    anti- CXADR antibody
    FNab02091 100µg
    EUR 505.25
    • Immunogen: coxsackie virus and adenovirus receptor
    • Uniprot ID: P78310
    • Gene ID: 1525
    • Research Area: Immunology
    Description: Antibody raised against CXADR
    CXADR Blocking Peptide
    20-abx062498
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.
    CXADR Polyclonal Antibody
    A58698 100 µg
    EUR 570.55
    Description: The best epigenetics products
    CXADR Rabbit pAb
    A1822-100ul 100 ul
    EUR 308
    CXADR Rabbit pAb
    A1822-200ul 200 ul
    EUR 459
    CXADR Rabbit pAb
    A1822-20ul 20 ul
    EUR 183
    CXADR Rabbit pAb
    A1822-50ul 50 ul
    EUR 223
    CXADR Blocking Peptide
    33R-4065 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CXADR antibody, catalog no. 70R-6982
    CXADR Blocking Peptide
    DF6638-BP 1mg
    EUR 195
    CXADR Blocking Peptide
    DF3973-BP 1mg
    EUR 195
    Anti-CXADR antibody
    PAab02091 100 ug
    EUR 355
    pCMV-SPORT6-CXADR
    PVT13265 2 ug
    EUR 391
    Anti-CXADR antibody
    STJ23296 100 µl
    EUR 277
    Description: The protein encoded by this gene is a type I membrane receptor for group B coxsackieviruses and subgroup C adenoviruses. Several transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene are found on chromosomes 15, 18, and 21.
    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.