Human KTN1(Kinectin 1) ELISA Kit

Human KTN1(Kinectin 1) ELISA Kit

To Order Contact us: 

    Human Kinectin 1 (KTN1) ELISA Kit

    4-SEC558Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Kinectin 1 elisa. Alternative names of the recognized antigen: CG1
    • KNT
    • Kinesin Receptor
    • CG-1 antigen
    • Kinesin receptor
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kinectin 1 (KTN1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Kinectin 1(KTN1)ELISA Kit

    QY-E04839 96T
    EUR 361

    Human Kinectin, KTN1 ELISA KIT

    ELI-43334h 96 Tests
    EUR 824

    Kinectin 1 (KTN1) Antibody

    20-abx113377
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Kinectin 1 (KTN1) Antibody

    20-abx130873
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Kinectin 1 (KTN1) Antibody

    20-abx130874
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Kinectin 1 (KTN1) Antibody

    abx146420-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Kinectin 1 (KTN1) Antibody

    20-abx004510
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Kinectin 1 (KTN1) Antibody

    20-abx338653
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Kinectin 1 (KTN1) Antibody

    abx234660-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Recombinant Kinectin 1 (KTN1)

    4-RPC558Hu01
    • EUR 444.06
    • EUR 222.00
    • EUR 1390.24
    • EUR 530.08
    • EUR 960.16
    • EUR 360.00
    • EUR 3325.60
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q86UP2
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 33.2kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Kinectin 1 expressed in: E.coli

    Recombinant Kinectin 1 (KTN1)

    4-RPC558Ra01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: D4A4Z9
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 22.8kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Rat Kinectin 1 expressed in: E.coli

    Human Kinectin 1 (KTN1) Protein

    20-abx650030
    • EUR 620.00
    • EUR 272.00
    • EUR 1873.00
    • EUR 732.00
    • EUR 453.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    ELISA kit for Human KTN1 (Kinectin 1)

    ELK5160 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kinectin 1 (KTN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kinectin 1 (KTN1
    • Show more
    Description: A sandwich ELISA kit for detection of Kinectin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Kinectin 1 (KTN1) CLIA Kit

    20-abx493764
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Chicken Kinectin, KTN1 ELISA KIT

    ELI-12505c 96 Tests
    EUR 928

    Mouse Kinectin, Ktn1 ELISA KIT

    ELI-08766m 96 Tests
    EUR 865

    ELISA kit for Human Kinectin (KTN1)

    KTE61871-48T 48T
    EUR 332
    • Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Kinectin (KTN1)

    KTE61871-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Kinectin (KTN1)

    KTE61871-96T 96T
    EUR 539
    • Kinectin is a protein encoded by the KTN1 gene.Various cellular organelles and vesicles are transported along the microtubules in the cytoplasm. Likewise, membrane recycling of the endoplasmic reticulum (ER), Golgi assembly at the microtubule organiz
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Kinectin (KTN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Rat Kinectin 1 (KTN1) Protein

    20-abx650031
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Kinectin 1 (KTN1) Antibody (HRP)

    20-abx336246
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Kinectin 1 (KTN1) Antibody (FITC)

    20-abx336247
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Kinectin 1 (KTN1) Antibody (Biotin)

    20-abx336248
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig)

    4-PAC558Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1)

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat)

    4-PAC558Ra01
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1)

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), APC

    4-PAC558Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with APC.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), Biotinylated

    4-PAC558Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with Biotin.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), Cy3

    4-PAC558Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with Cy3.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), FITC

    4-PAC558Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with FITC.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), HRP

    4-PAC558Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with HRP.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), PE

    4-PAC558Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with PE.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), APC

    4-PAC558Ra01-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with APC.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), Biotinylated

    4-PAC558Ra01-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with Biotin.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), Cy3

    4-PAC558Ra01-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with Cy3.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), FITC

    4-PAC558Ra01-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with FITC.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), HRP

    4-PAC558Ra01-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with HRP.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), PE

    4-PAC558Ra01-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with PE.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Pig), APC-Cy7

    4-PAC558Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1104~Glu1357)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Pig Kinectin 1 (KTN1). This antibody is labeled with APC-Cy7.

    Kinectin 1 (KTN1) Polyclonal Antibody (Human, Rat), APC-Cy7

    4-PAC558Ra01-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KTN1 (Glu1162~Lys1325)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Rat Kinectin 1 (KTN1). This antibody is labeled with APC-Cy7.

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    KTN1 ELISA KIT|Human

    EF010598 96 Tests
    EUR 689

    Kinectin 1 antibody

    70R-6709 50 ug
    EUR 467
    Description: Rabbit polyclonal Kinectin 1 antibody

    KTN1 ELISA Kit (Human) (OKCD01205)

    OKCD01205 96 Wells
    EUR 831
    Description: Description of target: Receptor for kinesin thus involved in kinesin-driven vesicle motility. Accumulates in integrin-based adhesion complexes (IAC) upon integrin aggregation by fibronectin. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 30 pg/mL

    Recombinant human Kinectin

    P2662 100ug Ask for price
    • Uniprot ID: Q86UP2
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human Kinectin

    Kinectin 1 Blocking Peptide

    33R-2373 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KTN1 antibody, catalog no. 70R-6709

    KTN1 siRNA

    20-abx922172
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    KTN1 siRNA

    20-abx922173
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    KTN1 antibody

    38704-100ul 100ul
    EUR 252

    KTN1 antibody

    70R-18197 50 ul
    EUR 435
    Description: Rabbit polyclonal KTN1 antibody

    KTN1 Antibody

    1-CSB-PA012700GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

    KTN1 Antibody

    1-CSB-PA773030LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IP:1:200-1:2000

    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes

    mRNAExpress mRNA Synthesis kit (5 reactions)

    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products

    Human KTN1 shRNA Plasmid

    20-abx952639
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    KTN1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1191202 1.0 ug DNA
    EUR 154

    KTN1 Conjugated Antibody

    C38704 100ul
    EUR 397

    anti- KTN1 antibody

    FNab04660 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • Immunogen: kinectin 1 (kinesin receptor)
    • Uniprot ID: Q86UP2
    • Gene ID: 3895
    • Research Area: Signal Transduction
    Description: Antibody raised against KTN1

    KTN1 Rabbit pAb

    A12456-100ul 100 ul
    EUR 308

    KTN1 Rabbit pAb

    A12456-200ul 200 ul
    EUR 459

    KTN1 Rabbit pAb

    A12456-20ul 20 ul
    EUR 183

    KTN1 Rabbit pAb

    A12456-50ul 50 ul
    EUR 223

    KTN1 Rabbit pAb

    A5879-100ul 100 ul
    EUR 308

    KTN1 Rabbit pAb

    A5879-200ul 200 ul
    EUR 459

    KTN1 Rabbit pAb

    A5879-20ul 20 ul
    EUR 183

    KTN1 Rabbit pAb

    A5879-50ul 50 ul
    EUR 223

    KTN1 Rabbit pAb

    A14016-100ul 100 ul
    EUR 308

    KTN1 Rabbit pAb

    A14016-200ul 200 ul
    EUR 459

    KTN1 Rabbit pAb

    A14016-20ul 20 ul
    EUR 183

    KTN1 Rabbit pAb

    A14016-50ul 50 ul
    EUR 223

    KTN1 Polyclonal Antibody

    A69971 100 ?g
    EUR 628.55
    Description: The best epigenetics products

    KTN1 cloning plasmid

    CSB-CL773030HU-10ug 10ug
    EUR 1377
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 3921
    • Sequence: atggagttttatgagtcagcatattttattgttcttattccttcaatagttattacagtaattttcctcttcttctggcttttcatgaaagaaacattatatgatgaagttcttgcaaaacagaaaagagaacaaaagcttattcctaccaaaacagataaaaagaaagcagaaa
    • Show more
    Description: A cloning plasmid for the KTN1 gene.

    Anti-KTN1 antibody

    PAab04660 100 ug
    EUR 386

    Anti-KTN1 antibody

    STJ28152 100 µl
    EUR 277
    Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene.

    Anti-KTN1 antibody

    STJ114330 100 µl
    EUR 277
    Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene.

    Anti-KTN1 antibody

    STJ115951 100 µl
    EUR 277
    Description: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene.

    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    KTN1 ORF Vector (Human) (pORF)

    ORF013543 1.0 ug DNA
    EUR 354

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

    AP-STR-KIT-1 1/pk
    EUR 355
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Mouse KTN1 shRNA Plasmid

    20-abx971260
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    KTN1 Antibody, HRP conjugated

    1-CSB-PA773030LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    KTN1 Antibody, FITC conjugated

    1-CSB-PA773030LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    KTN1 Antibody, Biotin conjugated

    1-CSB-PA773030LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against KTN1. Recognizes KTN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    Ktn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4810402 1.0 ug DNA
    EUR 154

    Human Glutaredoxin-1 AssayMax ELISA Kit

    EG2153-1 96 Well Plate
    EUR 417

    Human Complexin-1 AssayMax ELISA Kit

    EC3505-1 96 Well Plate
    EUR 417

    Human Hexokinase-1 AssayMax ELISA Kit

    EH3101-1 96 Well Plate
    EUR 477

    KTN1 sgRNA CRISPR Lentivector set (Human)

    K1191201 3 x 1.0 ug
    EUR 339

    KTN1-AS1 ORF Vector (Human) (pORF)

    ORF022577 1.0 ug DNA Ask for price

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE622A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE624A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    Human Lipocalin-1 (LCN1) AssayMax ELISA Kit

    EL3502-1 96 Well Plate
    EUR 477

    Human TGF-beta-1 AssayMax ELISA Kit

    ET3102-1 96 Well Plate
    EUR 477

    Human PAI-1/tPA AssayMax ELISA Kit

    EP1105-1 96 Well Plate
    EUR 417

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    Human KRAB-associated Protein 1 (KAP-1) AssayMax ELISA Kit

    EK2802-1 96 Well Plate
    EUR 477

    Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

    EI2200-1 96 Well Plate
    EUR 477

    Human Interleukin-1-alpha (IL-1-alpha) AssayMax ELISA Kit

    EI2301-1 96 Well Plate
    EUR 477

    Human Plasminogen Activator Inhibitor-1 (PAI-1) AssayMax ELISA Kit

    EP1100-1 96 Well Plate
    EUR 417

    KTN1 Polyclonal Antibody, HRP Conjugated

    A69972 100 ?g
    EUR 628.55
    Description: kits suitable for this type of research

    KTN1 Polyclonal Antibody, FITC Conjugated

    A69973 100 ?g
    EUR 628.55
    Description: fast delivery possible

    KTN1 Polyclonal Antibody, Biotin Conjugated

    A69974 100 ?g
    EUR 628.55
    Description: reagents widely cited

    Ktn1 ORF Vector (Mouse) (pORF)

    ORF048908 1.0 ug DNA
    EUR 506

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    KTN1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1191203 1.0 ug DNA
    EUR 154

    KTN1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1191204 1.0 ug DNA
    EUR 154

    KTN1 Protein Vector (Human) (pPB-C-His)

    PV054169 500 ng
    EUR 481

    KTN1 Protein Vector (Human) (pPB-N-His)

    PV054170 500 ng
    EUR 481

    KTN1 Protein Vector (Human) (pPM-C-HA)

    PV054171 500 ng
    EUR 481

    KTN1 Protein Vector (Human) (pPM-C-His)

    PV054172 500 ng
    EUR 481

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Human Glutathione Transferase zeta 1 AssayMax ELISA Kit

    EG2350-1 96 Well Plate
    EUR 477

    Human Glutathione Peroxidase 1 (GPX1) AssayMax ELISA Kit

    EG3928-1 96 Well Plate
    EUR 477

    Human Carbonic Anhydrase 1 (CA1) AssayMax ELISA Kit

    EC5752-1 96 Well Plate
    EUR 477

    Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

    EA5001-1 96 Well Plate
    EUR 417

    Human Alpha-1-Antitrypsin (A1AT) AssayMax ELISA Kit

    EA5101-1 96 Well Plate
    EUR 417

    Human Alpha-1-Antichymotrypsin (AACT) AssayMax ELISA Kit

    EA5501-1 96 Well Plate
    EUR 417

    Human Estrogen Sulfotransferase (EST-1) AssayMax ELISA Kit

    EE2702-1 96 Well Plate
    EUR 477

    Human Alpha-1-Microglobulin (A1M) AssayMax ELISA Kit

    EM5110-1 96 Well Plate
    EUR 396

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit

    EI1001-1 96 Well Plate
    EUR 477

    Human Heat Shock Factor Protein 1 (HSF 1) AssayMax ELISA kit

    EH5215-1 96 Well Plate
    EUR 417

    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9

    KTN1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

    K1191206 1.0 ug DNA
    EUR 167

    Rat TIMP-1 AssayMax ELISA Kit

    ERT2538-1 96 Well Plate
    EUR 477

    Ktn1 sgRNA CRISPR Lentivector set (Mouse)

    K4810401 3 x 1.0 ug
    EUR 339

    Human Inhibitor of Growth Protein 1 (ING1) AssayMax ELISA Kit

    EI1770-1 96 Well Plate
    EUR 477

    Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit

    EG5001-1 96 Well Plate
    EUR 396

    Human Alpha-1-Acid Glycoprotein (Orosomucoid, AGP) AssayMax ELISA Kit

    EG5101-1 96 Well Plate
    EUR 396

    Human NEDD4 Family-Interacting Protein 1 (NDFIP1) AssayMax ELISA Kit

    EN2550-1 96 Well Plate
    EUR 477

    Human Alpha-1-Acid Glycoprotein 2 (ORM2, AGP2) AssayMax ELISA Kit

    EG2713-1 96 Well Plate
    EUR 417

    Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

    EMI2200-1 96 Well Plate
    EUR 477

    Human Lactoferrin AssayMax ELISA Kit

    EL1011-1 96 Well Plate
    EUR 417

    Human Leptin AssayMax ELISA Kit

    EL2001-1 96 Well Plate
    EUR 417

    Human Lactoferrin AssayMax ELISA Kit

    EL2011-1 96 Well Plate
    EUR 417

    Human Lysozyme AssayMax ELISA Kit

    EL3010-1 96 Well Plate
    EUR 396

    Human Lysozyme AssayMax ELISA Kit

    EL3020-1 96 Well Plate
    EUR 396

    Human ICAT AssayMax ELISA Kit

    EI3505-1 96 Well Plate
    EUR 477

    Human HPRT1 AssayMax ELISA Kit

    EH5337-1 96 Well Plate
    EUR 477

    Human HSD17B1 AssayMax ELISA Kit

    EH7102-1 96 Well Plate
    EUR 396

    Human Ferritin AssayMax ELISA Kit

    EF2003-1 96 Well Plate
    EUR 396

    Human GPIIbIIIa AssayMax ELISA Kit

    EG1060-1 96 Well Plate
    EUR 396

    Human Ghrelin AssayMax ELISA Kit

    EG3780-1 96 Well Plate
    EUR 509

    Human GARS AssayMax ELISA Kit

    EG5133-1 96 Well Plate
    EUR 477

    Human Geminin AssayMax ELISA Kit

    EG5701-1 96 Well Plate
    EUR 477

    Human GOT1 AssayMax ELISA Kit

    EG7150-1 96 Well Plate
    EUR 477

    Human CXCL7 AssayMax ELISA Kit

    EC2270-1 96 Well Plate
    EUR 477

    Human CNDP2 AssayMax ELISA Kit

    EC2505-1 96 Well Plate
    EUR 417

    Human CRYZ AssayMax ELISA Kit

    EC2720-1 96 Well Plate
    EUR 477

    Human Calprotectin AssayMax ELISA Kit

    EC3103-1 96 Well Plate
    EUR 477

    Human CCS AssayMax ELISA Kit

    EC3105-1 96 Well Plate
    EUR 417

    Human Catalase AssayMax ELISA Kit

    EC4208-1 96 Well Plate
    EUR 477

    Human Albumin AssayMax ELISA Kit

    EA2201-1 96 Well Plate
    EUR 396

    Human ADAMTS13 AssayMax ELISA Kit

    EA2550-1 96 Well Plate
    EUR 477

    Human ALKBH3 AssayMax ELISA Kit

    EA2622-1 96 Well Plate
    EUR 417

    Human Albumin AssayMax ELISA Kit

    EA3201-1 96 Well Plate
    EUR 417

    Human B3GAT3 AssayMax ELISA Kit

    EB3505-1 96 Well Plate
    EUR 477

    Human AZGP1 AssayMax ELISA Kit

    EA4728-1 96 Well Plate
    EUR 477

    Human AKR1B10 AssayMax ELISA Kit

    EA5403-1 96 Well Plate
    EUR 477

    Human GOT2 AssayMax ELISA Kit

    EA7652-1 96 Well Plate
    EUR 477

    Human Azurocidin AssayMax ELISA Kit

    EA8121-1 96 Well Plate
    EUR 477

    Human ARL2BP AssayMax ELISA Kit

    EA8710-1 96 Well Plate
    EUR 417

    Human DDT AssayMax ELISA Kit

    ED2527-1 96 Well Plate
    EUR 477

    Human ESM1 AssayMax ELISA Kit

    EE3520-1 96 Well Plate
    EUR 477

    Human Hemopexin AssayMax ELISA Kit

    EH1001-1 96 Well Plate
    EUR 396

    Human Haptoglobin AssayMax ELISA Kit

    EH1003-1 96 Well Plate
    EUR 396

    Human Hemopexin AssayMax ELISA Kit

    EH2001-1 96 Well Plate
    EUR 396

    Human Haptoglobin AssayMax ELISA Kit

    EH2003-1 96 Well Plate
    EUR 396

    Human HDHD2 AssayMax ELISA Kit

    EH2429-1 96 Well Plate
    EUR 477