Human tTBK2(Tau-Tubulin Kinase 2) ELISA Kit

Human tTBK2(Tau-Tubulin Kinase 2) ELISA Kit

To Order Contact us: 

    Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

    RD-tTBK2-Hu-96Tests 96 Tests
    EUR 723

    Human Tau- tubulin kinase 2, TTBK2 ELISA KIT

    ELI-40059h 96 Tests
    EUR 824

    Human Tau-Tubulin Kinase 2(tTBK2)ELISA Kit

    QY-E04375 96T
    EUR 400

    Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

    SEE723Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

    SEE723Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

    SEE723Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

    SEE723Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

    4-SEE723Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Tau-Tubulin Kinase 2 elisa. Alternative names of the recognized antigen: SCA11
    • Spinocerebellar Ataxia 11
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Tau-Tubulin Kinase 2 (tTBK2) Antibody

    20-abx129224
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Tau Tubulin Kinase 2 (TTBK2) Antibody

    20-abx006182
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Tau Tubulin Kinase 2 (TTBK2) Antibody

    20-abx003961
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.

    Tau Tubulin Kinase 2 (TTBK2) Antibody

    abx026626-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Tau Tubulin Kinase 2 (TTBK2) Antibody

    abx026626-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Tau-Tubulin Kinase 2 (tTBK2) Antibody

    20-abx174723
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Tau Tubulin Kinase 2 (TTBK2) Antibody

    20-abx320391
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Tau Tubulin Kinase 2 (TTBK2) Antibody

    abx239076-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Tau-Tubulin Kinase 2 (TTBK2) Antibody

    20-abx212443
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Tau-Tubulin Kinase 2 (TTBK2) Antibody

    20-abx212444
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Recombinant Tau-Tubulin Kinase 2 (tTBK2)

    4-RPE723Hu01
    • EUR 503.20
    • EUR 238.00
    • EUR 1612.00
    • EUR 604.00
    • EUR 1108.00
    • EUR 400.00
    • EUR 3880.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q6IQ55
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 63.7kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Tau-Tubulin Kinase 2 expressed in: E.coli

    Human Tau-Tubulin Kinase 2 (tTBK2) Protein

    20-abx168270
    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Mouse Tau- tubulin kinase 2, Ttbk2 ELISA KIT

    ELI-23115m 96 Tests
    EUR 865

    Human Tau-Tubulin Kinase 2 (tTBK2) CLIA Kit

    20-abx494710
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human tTBK2 (Tau-Tubulin Kinase 2)

    ELK4778 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tau-Tubulin Kinase 2 (tTBK2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tau-T
    • Show more
    Description: A sandwich ELISA kit for detection of Tau-Tubulin Kinase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Tau-tubulin kinase 2 (TTBK2)

    KTE60120-48T 48T
    EUR 332
    • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tau-tubulin kinase 2 (TTBK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Tau-tubulin kinase 2 (TTBK2)

    KTE60120-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tau-tubulin kinase 2 (TTBK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Tau-tubulin kinase 2 (TTBK2)

    KTE60120-96T 96T
    EUR 539
    • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Tau-tubulin kinase 2 (TTBK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human)

    4-PAE723Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2)

    Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), APC

    4-PAE723Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with APC.

    Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), Biotinylated

    4-PAE723Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with Biotin.

    Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), Cy3

    4-PAE723Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with Cy3.

    Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), FITC

    4-PAE723Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with FITC.

    Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), HRP

    4-PAE723Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with HRP.

    Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), PE

    4-PAE723Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with PE.

    Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), APC-Cy7

    4-PAE723Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with APC-Cy7.

    Human Tau-Tubulin Kinase 2 (SCA11) ELISA Kit

    20-abx153233
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Tau Tubulin Kinase 2 Antibody

    20-abx115998
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    anti-Tau tubulin kinase 2

    YF-PA22380 50 ug
    EUR 363
    Description: Mouse polyclonal to Tau tubulin kinase 2

    Human Tau- tubulin kinase 1, TTBK1 ELISA KIT

    ELI-40058h 96 Tests
    EUR 824

    Recombinant human Tau-tubulin kinase 1

    P2423 100ug Ask for price
    • Uniprot ID: Q5TCY1
    • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
    Description: Recombinant protein for human Tau-tubulin kinase 1

    Mouse Tau- tubulin kinase 1, Ttbk1 ELISA KIT

    ELI-16658m 96 Tests
    EUR 865

    Tau Tubulin Kinase 1 (TTBK1) Antibody

    abx031335-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Tau Tubulin Kinase 1 (TTBK1) Antibody

    abx031335-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Tau Tubulin Kinase 1 (TTBK1) Antibody

    20-abx210738
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    ELISA kit for Mouse Tau-tubulin kinase 1 (TTBK1)

    KTE70049-48T 48T
    EUR 332
    • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Tau-tubulin kinase 1 (TTBK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Tau-tubulin kinase 1 (TTBK1)

    KTE70049-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Tau-tubulin kinase 1 (TTBK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Tau-tubulin kinase 1 (TTBK1)

    KTE70049-96T 96T
    EUR 539
    • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Tau-tubulin kinase 1 (TTBK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    TTBK2 ELISA KIT|Human

    EF003916 96 Tests
    EUR 689

    Human τPK1(Tau-Protein Kinase) ELISA Kit

    EH4001 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: Q9H3S4
    • Alias: τPK1
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    TTBK2 ELISA Kit (Human) (OKCD00945)

    OKCD00945 96 Wells
    EUR 831
    Description: Description of target: Serine/threonine kinase that acts as a key regulator of ciliogenesis: controls the initiation of ciliogenesis by binding to the distal end of the basal body and promoting the removal of CCP110, which caps the mother centriole, leading to the recruitment of IFT proteins, which build the ciliary axoneme. Has some substrate preference for proteins that are already phosphorylated on a Tyr residue at the +2 position relative to the phosphorylation site. Able to phosphorylate tau on serines in vitro.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.6"TTBK2 kinase substrate specificity and the impact of spinocerebellar-ataxia-causing mutations on expression, activity, localization and development."_x005F_x005F_x000D_Bouskila M., Esoof N., Gay L., Fang E.H., Deak M., Begley M.J., Cantley L.C., Prescott A., Storey K.G., Alessi D.R._x005F_x005F_x000D_Biochem. J. 437:157-167(2011) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, CATALYTIC ACTIVITY, BIOPHYSICOCHEMICAL PROPERTIES, SUBCELLULAR LOCATION, MUTAGENESIS OF LYS-50; LYS-143; ASP-163; ARG-181 AND ALA-184.Ref.9"The spinocerebellar ataxia-associated gene tau tubulin kinase 2 controls the initiation of ciliogenesis."_x005F_x005F_x000D_Goetz S.C., Liem K.F. Jr., Anderson K.V._x005F_x005F_x000D_Cell 151:847-858(2012) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.124 ng/mL

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Human Tau-Protein Kinase 1 (TPK1) ELISA Kit

    20-abx153232
    • EUR 7112.00
    • EUR 3792.00
    • EUR 879.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Tau-Protein Kinase 1 (TPK1) ELISA Kit

    abx358325-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Human Tau-Protein Kinase 1 (TTBK1) ELISA Kit

    abx253405-96tests 96 tests
    EUR 637
    • Shipped within 5-12 working days.

    Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

    DLR-tPK1-Hu-48T 48T
    EUR 498
    • Should the Human Tau-Protein Kinase 1 (tPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Tau-Protein Kinase 1 (tPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

    DLR-tPK1-Hu-96T 96T
    EUR 647
    • Should the Human Tau-Protein Kinase 1 (tPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Tau-Protein Kinase 1 (tPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

    SEB984Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4502.43
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

    Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

    SEB984Hu-1x48wellstestplate 1x48-wells test plate
    EUR 458.44
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

    Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

    SEB984Hu-1x96wellstestplate 1x96-wells test plate
    EUR 612.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

    Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

    SEB984Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2454.23
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

    Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

    4-SEB984Hu
    • EUR 4553.00
    • EUR 2405.00
    • EUR 613.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Tau-Protein Kinase 1 elisa. Alternative names of the recognized antigen: TTBK1
    • BDTK
    • TTK
    • Cdk5/P20
    • CDK5/P23
    • GSK
    • STK31
    • Brain-derived tau kinase
    • Tau-Tubulin Kinase 1
    • Tau-Protein O-Hosphotransferase
    • Brain Protein Kinase PK40erk
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tau-Protein Kinase 1 (tPK1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

    RDR-tPK1-Hu-48Tests 48 Tests
    EUR 522

    Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

    RDR-tPK1-Hu-96Tests 96 Tests
    EUR 724

    Human Tau-Protein Kinase 1 ELISA Kit (tPK1)

    RK02434 96 Tests
    EUR 521

    Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

    RD-tPK1-Hu-48Tests 48 Tests
    EUR 500

    Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

    RD-tPK1-Hu-96Tests 96 Tests
    EUR 692

    Human Tau-Protein Kinase 1(tPK1)ELISA Kit

    QY-E04376 96T
    EUR 400

    Human Tau-Protein Kinase (τPK1) CLIA Kit

    20-abx493333
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Tau-Protein Kinase (τPK1) CLIA Kit

    abx197758-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    ELISA kit for Human tPK1 (Tau-Protein Kinase 1)

    ELK2730 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tau-Protein Kinase 1 (tPK1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tau-Pr
    • Show more
    Description: A sandwich ELISA kit for detection of Tau-Protein Kinase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human ?PK1 (Tau-Protein Kinase 1)

    E-EL-H1550 1 plate of 96 wells
    EUR 534
    • Gentaur's ?PK1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ?PK1. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human ?PK1 (Tau-Protein Kinase 1) in samples from Serum, Plasma, Cell supernatant

    Human Tau ELISA Kit

    EHT0031 96Tests
    EUR 521

    Anti- Beta-tubulin Monoclonal Antibody

    M05613-2 100ul
    EUR 397
    Description: Mouse Monoclonal Beta-tubulin Antibody. Validated in IF, IHC, WB and tested in Human, Monkey, Mouse, Rat.

    Human gamma Tubulin (gamma Tubulin) ELISA Kit

    abx259584-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Tubulin Gamma 2(TUBg2)ELISA Kit

    QY-E01095 96T
    EUR 361

    Pig Tau-Protein Kinase 1 (TTBK1) ELISA Kit

    abx360764-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Rabbit Tau-Protein Kinase 1 (TTBK1) ELISA Kit

    abx363709-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Sheep Tau-Protein Kinase 1 (TTBK1) ELISA Kit

    abx364420-96tests 96 tests
    EUR 926
    • Shipped within 5-12 working days.

    Monkey Tau-Protein Kinase 1 (TTBK1) ELISA Kit

    abx359053-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Chicken Tau-Protein Kinase 1 (TTBK1) ELISA Kit

    abx355866-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    TTBK2 siRNA

    20-abx938412
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TTBK2 siRNA

    20-abx938413
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TTBK2 antibody

    70R-21044 50 ul
    EUR 435
    Description: Rabbit polyclonal TTBK2 antibody

    Ttbk2 antibody

    70R-8045 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal Ttbk2 antibody

    TTBK2 Antibody

    ABD2688 100 ug
    EUR 438

    TTBK2 Antibody

    43172-100ul 100ul
    EUR 252

    TTBK2 Antibody

    25447-100ul 100ul
    EUR 390

    TTBK2 Antibody

    1-CSB-PA930884
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

    TTBK2 Antibody

    DF2688 200ul
    EUR 304
    Description: TTBK2 antibody detects endogenous levels of total TTBK2.

    TTBK2 Antibody

    1-CSB-PA753711DSR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    TTBK2 Antibody

    1-CSB-PA224049
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

    TTBK2 Antibody

    1-CSB-PA025202GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    Anti-Phospho-Tau (S396) Rabbit Monoclonal Antibody

    P00097-2 100ug/vial
    EUR 397
    Description: Rabbit Monoclonal Phospho-Tau (S396) Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

    TTBK2 sgRNA CRISPR Lentivector (Human) (Target 2)

    K2546703 1.0 ug DNA
    EUR 154

    Human TTBK2 shRNA Plasmid

    20-abx965454
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

    AP-STR-KIT-2 1/pk
    EUR 367
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Human Tau Protein ELISA kit

    E01T0024-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tau Protein ELISA kit

    E01T0024-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tau Protein ELISA kit

    E01T0024-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Tau / MAPT (Human) ELISA Kit

    K4263-100
    EUR 805

    Human Tau proteins ELISA kit

    CSB-E12011h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Tau proteins in samples from serum, plasma, cerebrospinalfluid (CSF). A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Tau proteins ELISA kit

    1-CSB-E12011h
    • EUR 900.00
    • EUR 5476.00
    • EUR 2900.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Tau proteins in samples from serum, plasma, cerebrospinalfluid(CSF). Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Tubulin gamma- 2 chain, TUBG2 ELISA KIT

    ELI-29149h 96 Tests
    EUR 824

    MAPT 412a.a. Microtubule-Associated Protein Tau 412 a.a. Human Recombinant Protein

    PROTP10636-2 Regular: 5ug
    EUR 317
    Description: MAPT Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 432 amino acids (1-412 a.a.) and having a molecular mass of 45.1kDa (Molecular size on SDS-PAGE will appear higher). The MAPT is purified by proprietary chromatographic techniques.

    Anti-Tau Antibody (monoclonal, TAU-2)

    MA1093 100ug/vial
    EUR 334

    Human β tubulin ELISA kit

    E01T0555-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human β tubulin ELISA kit

    E01T0555-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human β tubulin ELISA kit

    E01T0555-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Tubulin-beta ELISA KIT|Human

    EF003944 96 Tests
    EUR 689

    gamma Tubulin ELISA KIT|Human

    EF009775 96 Tests
    EUR 689

    alpha Tubulin ELISA KIT|Human

    EF007730 96 Tests
    EUR 689

    human ?-tubulin,TUBB ELISA kit

    201-12-1609 96 tests
    EUR 440
    • This ?-tubulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Bovine Interferon tau- 2, IFNT2 ELISA KIT

    ELI-20137b 96 Tests
    EUR 928

    CLIA kit for Human ?PK1 (Tau-Protein Kinase 1)

    E-CL-H0994 1 plate of 96 wells
    EUR 584
    • Gentaur's ?PK1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ?PK1 . Standards or samples are added to the micro CLIA plate wells and combined with the
    • Show more
    Description: A sandwich CLIA kit for quantitative measurement of Human ?PK1 (Tau-Protein Kinase 1) in samples from Serum, Plasma, Cell supernatant

    Human Tau-Protein Kinase 1 (tPK1) Protein

    20-abx168803
    • EUR 648.00
    • EUR 272.00
    • EUR 1998.00
    • EUR 773.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Anti- alpha -Tubulin Rabbit Monoclonal Antibody, Clone#RM113

    M08382-2 100uL
    EUR 397
    Description: Anti- alpha -Tubulin Rabbit Monoclonal Antibody, Clone#RM113 tested in WB, IP, ICC, IHC, FC, ELISA , reactive to All Species

    Anti-Rsk 2/MAPKAP Kinase 1b/RPS6KA3 Antibody

    A02215-2 100ug/vial
    EUR 334

    Taurine (Tau) ELISA Kit

    20-abx585011
    • EUR 7911.00
    • EUR 4215.00
    • EUR 973.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Goat Tau ELISA Kit

    EGTT0031 96Tests
    EUR 521

    Bovine Tau ELISA Kit

    EBT0031 96Tests
    EUR 521

    Chicken Tau ELISA Kit

    ECKT0031 96Tests
    EUR 521

    Anserini Tau ELISA Kit

    EAT0031 96Tests
    EUR 521

    Canine Tau ELISA Kit

    ECT0031 96Tests
    EUR 521

    Porcine Tau ELISA Kit

    EPT0031 96Tests
    EUR 521

    Rat Tau ELISA Kit

    ERT0031 96Tests
    EUR 521

    Sheep Tau ELISA Kit

    EST0031 96Tests
    EUR 521

    Rabbit Tau ELISA Kit

    ERTT0031 96Tests
    EUR 521

    Monkey Tau ELISA Kit

    EMKT0031 96Tests
    EUR 521

    Mouse Tau ELISA Kit

    EMT0031 96Tests
    EUR 521

    Rat(TAU) ELISA Kit

    QY-E11751 96T
    EUR 374

    TTBK2 Conjugated Antibody

    C43172 100ul
    EUR 397

    Polyclonal TTBK2 Antibody

    APR13842G 0.1 mg
    EUR 659
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TTBK2 . This antibody is tested and proven to work in the following applications:

    anti- TTBK2 antibody

    FNab09076 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • Immunogen: tau tubulin kinase 2
    • Uniprot ID: Q6IQ55
    • Gene ID: 146057
    • Research Area: Neuroscience, Cell Division and Proliferation, Metabolism
    Description: Antibody raised against TTBK2

    TTBK2 Rabbit pAb

    A5168-100ul 100 ul
    EUR 308

    TTBK2 Rabbit pAb

    A5168-200ul 200 ul
    EUR 459

    TTBK2 Rabbit pAb

    A5168-20ul 20 ul Ask for price

    TTBK2 Rabbit pAb

    A5168-50ul 50 ul Ask for price

    TTBK2 Rabbit pAb

    A13448-100ul 100 ul
    EUR 308

    TTBK2 Rabbit pAb

    A13448-200ul 200 ul
    EUR 459

    TTBK2 Rabbit pAb

    A13448-20ul 20 ul
    EUR 183

    TTBK2 Rabbit pAb

    A13448-50ul 50 ul
    EUR 223

    TTBK2 Rabbit pAb

    A7609-100ul 100 ul
    EUR 308

    TTBK2 Rabbit pAb

    A7609-200ul 200 ul
    EUR 459

    TTBK2 Rabbit pAb

    A7609-20ul 20 ul
    EUR 183

    TTBK2 Rabbit pAb

    A7609-50ul 50 ul
    EUR 223

    Ttbk2 Blocking Peptide

    33R-4581 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Ttbk2 antibody, catalog no. 70R-8045

    TTBK2 Blocking Peptide

    DF2688-BP 1mg
    EUR 195

    TTBK2 cloning plasmid

    CSB-CL753711HU-10ug 10ug
    EUR 1316
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 3735
    • Sequence: atgagtgggggaggagagcagccggatatcctgagtgttggaatcctagtgaaagaaagatggaaagtgttgagaaagattgggggtgggggctttggagaaatttacgatgccttggacatgctcaccagggaaaatgttgcactgaaggtggaatcagctcaacaaccaaaac
    • Show more
    Description: A cloning plasmid for the TTBK2 gene.

    Anti-TTBK2 antibody

    PAab09076 100 ug
    EUR 386

    Anti-TTBK2 antibody

    STJ29746 100 µl
    EUR 277
    Description: This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem.

    Anti-TTBK2 antibody

    STJ27147 100 µl
    EUR 277
    Description: This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem.

    Anti-TTBK2 antibody

    STJ115409 100 µl
    EUR 277
    Description: This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem.

    Human Microtubule Associated Protein Tau/Tau Protein (MAPT) ELISA Kit

    20-abx152272
    • EUR 7112.00
    • EUR 3792.00
    • EUR 879.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Microtubule Associated Protein Tau/Tau Protein (MAPT) ELISA Kit

    abx251357-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Gamma- tubulin complex component 2, TUBGCP2 ELISA KIT

    ELI-08158h 96 Tests
    EUR 824

    Human Phosphorylated tau 231 ELISA kit

    E01P0580-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 231 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phosphorylated tau 231 ELISA kit

    E01P0580-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 231 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phosphorylated tau 231 ELISA kit

    E01P0580-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 231 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phosphorylated tau 181 ELISA kit

    E01P0581-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 181 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phosphorylated tau 181 ELISA kit

    E01P0581-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 181 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phosphorylated tau 181 ELISA kit

    E01P0581-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 181 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Phospho Tau (P181) ELISA Kit

    EH4701 96T
    EUR 567.6
    • Detection range: 7.813-500 pg/ml
    • Uniprot ID: P10636
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 4.688pg/ml

    Human phospho Tau Protein ELISA kit

    ELA-E1984h 96 Tests
    EUR 824

    TTBK2 ORF Vector (Human) (pORF)

    ORF011086 1.0 ug DNA
    EUR 95

    Human MEK Kinase Kinase 2 (MAP4K2) ELISA Kit

    abx388410-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Tau-Protein Kinase 1 (tPK1) Antibody

    20-abx131659
    • EUR 411.00
    • EUR 133.00
    • EUR 1149.00
    • EUR 565.00
    • EUR 314.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Tau-Protein Kinase 1 (TPK1) Antibody

    abx145300-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Tau-Protein Kinase 1 (tPK1) Antibody

    20-abx174721
    • EUR 815.00
    • EUR 425.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Tau-Protein Kinase 1 (TPK1) Antibody

    abx238888-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Recombinant Tau-Protein Kinase 1 (tPK1)

    4-RPB984Hu01
    • EUR 467.36
    • EUR 228.00
    • EUR 1477.60
    • EUR 559.20
    • EUR 1018.40
    • EUR 376.00
    • EUR 3544.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q5TCY1
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 61.0kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Tau-Protein Kinase 1 expressed in: E.coli

    Human Tubulin Beta (TUBB) ELISA Kit

    abx570283-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Tubulin Alpha 3c ELISA kit

    E01T0366-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tubulin Alpha 3c ELISA kit

    E01T0366-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tubulin Alpha 3c ELISA kit

    E01T0366-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Acetylated tubulin Lys40 ELISA KIT|Human

    EF007566 96 Tests
    EUR 689

    Human β-tubulin(TUBB)ELISA Kit

    GA-E1625HM-48T 48T
    EUR 289

    Human β-tubulin(TUBB)ELISA Kit

    GA-E1625HM-96T 96T
    EUR 466

    Human Tubulin Beta (TUBB) ELISA Kit

    abx251297-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Tubulin Beta (TUBb) ELISA Kit

    DLR-TUBb-Hu-48T 48T
    EUR 498
    • Should the Human Tubulin Beta (TUBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Beta (TUBb) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    Human Tubulin Beta (TUBb) ELISA Kit

    DLR-TUBb-Hu-96T 96T
    EUR 647
    • Should the Human Tubulin Beta (TUBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Beta (TUBb) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    ELISA kit for Human TUB? (?-Tubulin)

    E-EL-H1006 1 plate of 96 wells
    EUR 534
    • Gentaur's TUB? ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TUB?. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human TUB? (?-Tubulin) in samples from Serum, Plasma, Cell supernatant

    Human Tubulin Beta (TUBb) ELISA Kit

    RDR-TUBb-Hu-48Tests 48 Tests
    EUR 522

    Human Tubulin Beta (TUBb) ELISA Kit

    RDR-TUBb-Hu-96Tests 96 Tests
    EUR 724

    Human Tubulin Beta (TUBb) ELISA Kit

    RD-TUBb-Hu-48Tests 48 Tests
    EUR 500

    Human Tubulin Beta (TUBb) ELISA Kit

    RD-TUBb-Hu-96Tests 96 Tests
    EUR 692

    Human Tubulin Epsilon(TUBe)ELISA Kit

    QY-E01093 96T
    EUR 361

    Human Tubulin Delta(TUBd)ELISA Kit

    QY-E01094 96T
    EUR 361

    Human Tubulin Beta(TUBb)ELISA Kit

    QY-E01101 96T
    EUR 361

    Human β-tubulin(TUBB)ELISA Kit

    QY-E04395 96T
    EUR 361

    ELISA kit for Human MAP? (Microtubule Associated Protein Tau/Tau Protein)

    E-EL-H0948 1 plate of 96 wells
    EUR 534
    • Gentaur's MAP? ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MAP?. Standards or samples are added to the micro ELISA plate wells and combined with th
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human MAP? (Microtubule Associated Protein Tau/Tau Protein) in samples from Serum, Plasma, Cell supernatant

    Bovine IFN Tau(IFN Tau)ELISA

    QY-E60043 96T
    EUR 426

    Tau-Protein Kinase 1 (tPK1) Polyclonal Antibody (Human)

    4-PAB984Hu01
    • EUR 239.00
    • EUR 2391.00
    • EUR 598.00
    • EUR 299.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: tPK1 (Trp34~Arg300)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Tau-Protein Kinase 1 (tPK1)

    Ttbk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4076703 1.0 ug DNA
    EUR 154

    Ttbk2 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6215403 1.0 ug DNA
    EUR 154

    Microtubule Associated Protein Tau / Tau Protein (MAPT) ELISA Kit

    abx595582-96tests 96 tests
    EUR 637
    • Shipped within 1-2 weeks.

    Human tyrosine kinase 2 ELISA Kit

    ELA-E1595h 96 Tests
    EUR 824

    Human RIO kinase 2 ELISA Kit

    ELA-E2243h 96 Tests
    EUR 824

    Tau (Tau 46)

    MO18002 100 ul
    EUR 483

    Bovine Tubulin gamma- 2 chain, TUBG2 ELISA KIT

    ELI-13734b 96 Tests
    EUR 928

    Mouse Tubulin gamma- 2 chain, Tubg2 ELISA KIT

    ELI-46474m 96 Tests
    EUR 865

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Tau (pS214) Cell ELISA Kit

    abx596057-296tests 2 × 96 tests
    EUR 707
    • Shipped within 1-2 weeks.

    Tau (pS262) Cell ELISA Kit

    abx596058-296tests 2 × 96 tests
    EUR 707
    • Shipped within 1-2 weeks.

    Tau (pS356) Cell ELISA Kit

    abx596059-296tests 2 × 96 tests
    EUR 707
    • Shipped within 1-2 weeks.

    Tau (pS396) Cell ELISA Kit

    abx596060-296tests 2 × 96 tests
    EUR 707
    • Shipped within 1-2 weeks.

    Mouse Tau Protein ELISA kit

    E03T0024-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Tau Protein ELISA kit

    E03T0024-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Tau Protein ELISA kit

    E03T0024-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Tau Protein ELISA kit

    E02T0024-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Tau Protein ELISA kit

    E02T0024-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Tau Protein ELISA kit

    E02T0024-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Tau Protein ELISA kit

    E04T0024-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Tau Protein ELISA kit

    E04T0024-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Tau Protein ELISA kit

    E04T0024-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Tau Protein ELISA kit

    E06T0024-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Tau Protein ELISA kit

    E06T0024-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Tau Protein ELISA kit

    E06T0024-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Bovine IFN- tau ELISA Kit

    ELA-E2106b 96 Tests
    EUR 928

    Guinea Pig Tau ELISA Kit

    EGT0031 96Tests
    EUR 521

    Dog Tau Protein ELISA kit

    E08T0024-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Tau Protein ELISA kit

    E08T0024-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Tau Protein ELISA kit

    E08T0024-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Tau Protein ELISA kit

    E07T0024-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Tau Protein ELISA kit

    E07T0024-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Tau Protein ELISA kit

    E07T0024-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.