Human tTBK2(Tau-Tubulin Kinase 2) ELISA Kit

Human tTBK2(Tau-Tubulin Kinase 2) ELISA Kit

To Order Contact us: 

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

RD-tTBK2-Hu-96Tests 96 Tests
EUR 723

Human Tau- tubulin kinase 2, TTBK2 ELISA KIT

ELI-40059h 96 Tests
EUR 824

Human Tau-Tubulin Kinase 2(tTBK2)ELISA Kit

QY-E04375 96T
EUR 400

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

SEE723Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

SEE723Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

SEE723Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

SEE723Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit

4-SEE723Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tau-Tubulin Kinase 2 elisa. Alternative names of the recognized antigen: SCA11
  • Spinocerebellar Ataxia 11
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Tau-Tubulin Kinase 2 (tTBK2) Antibody

20-abx129224
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tau Tubulin Kinase 2 (TTBK2) Antibody

20-abx006182
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tau Tubulin Kinase 2 (TTBK2) Antibody

20-abx003961
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Tau Tubulin Kinase 2 (TTBK2) Antibody

abx026626-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tau Tubulin Kinase 2 (TTBK2) Antibody

abx026626-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tau-Tubulin Kinase 2 (tTBK2) Antibody

20-abx174723
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tau Tubulin Kinase 2 (TTBK2) Antibody

20-abx320391
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tau Tubulin Kinase 2 (TTBK2) Antibody

abx239076-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Tau-Tubulin Kinase 2 (TTBK2) Antibody

20-abx212443
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Tau-Tubulin Kinase 2 (TTBK2) Antibody

20-abx212444
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Tau-Tubulin Kinase 2 (tTBK2)

4-RPE723Hu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6IQ55
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 63.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Tau-Tubulin Kinase 2 expressed in: E.coli

Mouse Tau- tubulin kinase 2, Ttbk2 ELISA KIT

ELI-23115m 96 Tests
EUR 865

Human Tau-Tubulin Kinase 2 (tTBK2) Protein

20-abx168270
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Tau-Tubulin Kinase 2 (tTBK2) CLIA Kit

20-abx494710
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human tTBK2 (Tau-Tubulin Kinase 2)

ELK4778 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tau-Tubulin Kinase 2 (tTBK2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tau-T
  • Show more
Description: A sandwich ELISA kit for detection of Tau-Tubulin Kinase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Tau-tubulin kinase 2 (TTBK2)

KTE60120-48T 48T
EUR 332
  • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tau-tubulin kinase 2 (TTBK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tau-tubulin kinase 2 (TTBK2)

KTE60120-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tau-tubulin kinase 2 (TTBK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tau-tubulin kinase 2 (TTBK2)

KTE60120-96T 96T
EUR 539
  • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tau-tubulin kinase 2 (TTBK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human)

4-PAE723Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2)

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), APC

4-PAE723Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with APC.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), Biotinylated

4-PAE723Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with Biotin.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), Cy3

4-PAE723Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with Cy3.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), FITC

4-PAE723Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with FITC.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), HRP

4-PAE723Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with HRP.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), PE

4-PAE723Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with PE.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), APC-Cy7

4-PAE723Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: tTBK2 (Trp21~Thr314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with APC-Cy7.

Human Tau-Tubulin Kinase 2 (SCA11) ELISA Kit

20-abx153233
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Tau Tubulin Kinase 2 Antibody

20-abx115998
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

anti-Tau tubulin kinase 2

YF-PA22380 50 ug
EUR 363
Description: Mouse polyclonal to Tau tubulin kinase 2

Human Tau- tubulin kinase 1, TTBK1 ELISA KIT

ELI-40058h 96 Tests
EUR 824

Recombinant human Tau-tubulin kinase 1

P2423 100ug Ask for price
  • Uniprot ID: Q5TCY1
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Tau-tubulin kinase 1

Mouse Tau- tubulin kinase 1, Ttbk1 ELISA KIT

ELI-16658m 96 Tests
EUR 865

Tau Tubulin Kinase 1 (TTBK1) Antibody

abx031335-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tau Tubulin Kinase 1 (TTBK1) Antibody

abx031335-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tau Tubulin Kinase 1 (TTBK1) Antibody

20-abx210738
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ELISA kit for Mouse Tau-tubulin kinase 1 (TTBK1)

KTE70049-48T 48T
EUR 332
  • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tau-tubulin kinase 1 (TTBK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tau-tubulin kinase 1 (TTBK1)

KTE70049-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tau-tubulin kinase 1 (TTBK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tau-tubulin kinase 1 (TTBK1)

KTE70049-96T 96T
EUR 539
  • TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tau-tubulin kinase 1 (TTBK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TTBK2 ELISA KIT|Human

EF003916 96 Tests
EUR 689

Human τPK1(Tau-Protein Kinase) ELISA Kit

EH4001 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9H3S4
  • Alias: τPK1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human Tau-Protein Kinase 1 (TPK1) ELISA Kit

20-abx153232
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tau-Protein Kinase 1 (TPK1) ELISA Kit

abx358325-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Tau-Protein Kinase 1 (TTBK1) ELISA Kit

abx253405-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

DLR-tPK1-Hu-48T 48T
EUR 498
  • Should the Human Tau-Protein Kinase 1 (tPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tau-Protein Kinase 1 (tPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

DLR-tPK1-Hu-96T 96T
EUR 647
  • Should the Human Tau-Protein Kinase 1 (tPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tau-Protein Kinase 1 (tPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

SEB984Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

SEB984Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

SEB984Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

SEB984Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

4-SEB984Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tau-Protein Kinase 1 elisa. Alternative names of the recognized antigen: TTBK1
  • BDTK
  • TTK
  • Cdk5/P20
  • CDK5/P23
  • GSK
  • STK31
  • Brain-derived tau kinase
  • Tau-Tubulin Kinase 1
  • Tau-Protein O-Hosphotransferase
  • Brain Protein Kinase PK40erk
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tau-Protein Kinase 1 (tPK1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

RDR-tPK1-Hu-48Tests 48 Tests
EUR 522

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

RDR-tPK1-Hu-96Tests 96 Tests
EUR 724

Human Tau-Protein Kinase 1 ELISA Kit (tPK1)

RK02434 96 Tests
EUR 521

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

RD-tPK1-Hu-48Tests 48 Tests
EUR 500

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit

RD-tPK1-Hu-96Tests 96 Tests
EUR 692

Human Tau-Protein Kinase 1(tPK1)ELISA Kit

QY-E04376 96T
EUR 400

Human Tau-Protein Kinase (τPK1) CLIA Kit

20-abx493333
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Tau-Protein Kinase (τPK1) CLIA Kit

abx197758-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Human tPK1 (Tau-Protein Kinase 1)

ELK2730 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tau-Protein Kinase 1 (tPK1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tau-Pr
  • Show more
Description: A sandwich ELISA kit for detection of Tau-Protein Kinase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human ?PK1 (Tau-Protein Kinase 1)

E-EL-H1550 1 plate of 96 wells
EUR 534
  • Gentaur's ?PK1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ?PK1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ?PK1 (Tau-Protein Kinase 1) in samples from Serum, Plasma, Cell supernatant

Human Tau ELISA Kit

EHT0031 96Tests
EUR 521

Human gamma Tubulin (gamma Tubulin) ELISA Kit

abx259584-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Anti- Beta-tubulin Monoclonal Antibody

M05613-2 100ul
EUR 397
Description: Mouse Monoclonal Beta-tubulin Antibody. Validated in IF, IHC, WB and tested in Human, Monkey, Mouse, Rat.

Human Tubulin Gamma 2(TUBg2)ELISA Kit

QY-E01095 96T
EUR 361

Pig Tau-Protein Kinase 1 (TTBK1) ELISA Kit

abx360764-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Tau-Protein Kinase 1 (TTBK1) ELISA Kit

abx363709-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Tau-Protein Kinase 1 (TTBK1) ELISA Kit

abx364420-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Monkey Tau-Protein Kinase 1 (TTBK1) ELISA Kit

abx359053-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Tau-Protein Kinase 1 (TTBK1) ELISA Kit

abx355866-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

TTBK2 siRNA

20-abx938412
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TTBK2 siRNA

20-abx938413
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TTBK2 antibody

70R-21044 50 ul
EUR 435
Description: Rabbit polyclonal TTBK2 antibody

Ttbk2 antibody

70R-8045 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Ttbk2 antibody

TTBK2 Antibody

ABD2688 100 ug
EUR 438

TTBK2 Antibody

43172-100ul 100ul
EUR 252

TTBK2 Antibody

25447-100ul 100ul
EUR 390

TTBK2 Antibody

1-CSB-PA930884
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TTBK2 Antibody

DF2688 200ul
EUR 304
Description: TTBK2 antibody detects endogenous levels of total TTBK2.

TTBK2 Antibody

1-CSB-PA753711DSR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TTBK2 Antibody

1-CSB-PA224049
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TTBK2 Antibody

1-CSB-PA025202GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Anti-Phospho-Tau (S396) Rabbit Monoclonal Antibody

P00097-2 100ug/vial
EUR 397
Description: Rabbit Monoclonal Phospho-Tau (S396) Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

TTBK2 sgRNA CRISPR Lentivector (Human) (Target 2)

K2546703 1.0 ug DNA
EUR 154

Human Tau Protein ELISA kit

E01T0024-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tau Protein ELISA kit

E01T0024-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tau Protein ELISA kit

E01T0024-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Tau / MAPT (Human) ELISA Kit

K4263-100
EUR 805

Human Tau proteins ELISA kit

CSB-E12011h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tau proteins in samples from serum, plasma, cerebrospinalfluid (CSF). A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tau proteins ELISA kit

1-CSB-E12011h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tau proteins in samples from serum, plasma, cerebrospinalfluid(CSF). Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human TTBK2 shRNA Plasmid

20-abx965454
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Tubulin gamma- 2 chain, TUBG2 ELISA KIT

ELI-29149h 96 Tests
EUR 824

MAPT 412a.a. Microtubule-Associated Protein Tau 412 a.a. Human Recombinant Protein

PROTP10636-2 Regular: 5ug
EUR 317
Description: MAPT Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 432 amino acids (1-412 a.a.) and having a molecular mass of 45.1kDa (Molecular size on SDS-PAGE will appear higher). The MAPT is purified by proprietary chromatographic techniques.

Human β tubulin ELISA kit

E01T0555-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β tubulin ELISA kit

E01T0555-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β tubulin ELISA kit

E01T0555-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Tubulin-beta ELISA KIT|Human

EF003944 96 Tests
EUR 689

gamma Tubulin ELISA KIT|Human

EF009775 96 Tests
EUR 689

alpha Tubulin ELISA KIT|Human

EF007730 96 Tests
EUR 689

human ?-tubulin,TUBB ELISA kit

201-12-1609 96 tests
EUR 440
  • This ?-tubulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Anti-Tau Antibody (monoclonal, TAU-2)

MA1093 100ug/vial
EUR 334

Bovine Interferon tau- 2, IFNT2 ELISA KIT

ELI-20137b 96 Tests
EUR 928

CLIA kit for Human ?PK1 (Tau-Protein Kinase 1)

E-CL-H0994 1 plate of 96 wells
EUR 584
  • Gentaur's ?PK1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ?PK1 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ?PK1 (Tau-Protein Kinase 1) in samples from Serum, Plasma, Cell supernatant

Human Tau-Protein Kinase 1 (tPK1) Protein

20-abx168803
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Anti- alpha -Tubulin Rabbit Monoclonal Antibody, Clone#RM113

M08382-2 100uL
EUR 397
Description: Anti- alpha -Tubulin Rabbit Monoclonal Antibody, Clone#RM113 tested in WB, IP, ICC, IHC, FC, ELISA , reactive to All Species

Taurine (Tau) ELISA Kit

20-abx585011
  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Goat Tau ELISA Kit

EGTT0031 96Tests
EUR 521

Bovine Tau ELISA Kit

EBT0031 96Tests
EUR 521

Chicken Tau ELISA Kit

ECKT0031 96Tests
EUR 521

Anserini Tau ELISA Kit

EAT0031 96Tests
EUR 521

Canine Tau ELISA Kit

ECT0031 96Tests
EUR 521

Porcine Tau ELISA Kit

EPT0031 96Tests
EUR 521

Rat Tau ELISA Kit

ERT0031 96Tests
EUR 521

Sheep Tau ELISA Kit

EST0031 96Tests
EUR 521

Rabbit Tau ELISA Kit

ERTT0031 96Tests
EUR 521

Monkey Tau ELISA Kit

EMKT0031 96Tests
EUR 521

Mouse Tau ELISA Kit

EMT0031 96Tests
EUR 521

Rat(TAU) ELISA Kit

QY-E11751 96T
EUR 374

Human Microtubule Associated Protein Tau/Tau Protein (MAPT) ELISA Kit

20-abx152272
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Microtubule Associated Protein Tau/Tau Protein (MAPT) ELISA Kit

abx251357-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Anti-Rsk 2/MAPKAP Kinase 1b/RPS6KA3 Antibody

A02215-2 100ug/vial
EUR 334

TTBK2 Conjugated Antibody

C43172 100ul
EUR 397

Polyclonal TTBK2 Antibody

APR13842G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TTBK2 . This antibody is tested and proven to work in the following applications:

anti- TTBK2 antibody

FNab09076 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: tau tubulin kinase 2
  • Uniprot ID: Q6IQ55
  • Gene ID: 146057
  • Research Area: Neuroscience, Cell Division and Proliferation, Metabolism
Description: Antibody raised against TTBK2

TTBK2 Rabbit pAb

A5168-100ul 100 ul
EUR 308

TTBK2 Rabbit pAb

A5168-200ul 200 ul
EUR 459

TTBK2 Rabbit pAb

A5168-20ul 20 ul Ask for price

TTBK2 Rabbit pAb

A5168-50ul 50 ul Ask for price

TTBK2 Rabbit pAb

A13448-100ul 100 ul
EUR 308

TTBK2 Rabbit pAb

A13448-200ul 200 ul
EUR 459

TTBK2 Rabbit pAb

A13448-20ul 20 ul
EUR 183

TTBK2 Rabbit pAb

A13448-50ul 50 ul
EUR 223

TTBK2 Rabbit pAb

A7609-100ul 100 ul
EUR 308

TTBK2 Rabbit pAb

A7609-200ul 200 ul
EUR 459

TTBK2 Rabbit pAb

A7609-20ul 20 ul
EUR 183

TTBK2 Rabbit pAb

A7609-50ul 50 ul
EUR 223

Ttbk2 Blocking Peptide

33R-4581 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Ttbk2 antibody, catalog no. 70R-8045

TTBK2 Blocking Peptide

DF2688-BP 1mg
EUR 195

TTBK2 cloning plasmid

CSB-CL753711HU-10ug 10ug
EUR 1316
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3735
  • Sequence: atgagtgggggaggagagcagccggatatcctgagtgttggaatcctagtgaaagaaagatggaaagtgttgagaaagattgggggtgggggctttggagaaatttacgatgccttggacatgctcaccagggaaaatgttgcactgaaggtggaatcagctcaacaaccaaaac
  • Show more
Description: A cloning plasmid for the TTBK2 gene.

Anti-TTBK2 antibody

PAab09076 100 ug
EUR 386

Anti-TTBK2 antibody

STJ29746 100 µl
EUR 277
Description: This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem.

Anti-TTBK2 antibody

STJ27147 100 µl
EUR 277
Description: This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem.

Anti-TTBK2 antibody

STJ115409 100 µl
EUR 277
Description: This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem.

Human Gamma- tubulin complex component 2, TUBGCP2 ELISA KIT

ELI-08158h 96 Tests
EUR 824

Human Phosphorylated tau 231 ELISA kit

E01P0580-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 231 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphorylated tau 231 ELISA kit

E01P0580-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 231 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphorylated tau 231 ELISA kit

E01P0580-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 231 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphorylated tau 181 ELISA kit

E01P0581-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 181 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphorylated tau 181 ELISA kit

E01P0581-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 181 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphorylated tau 181 ELISA kit

E01P0581-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 181 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospho Tau (P181) ELISA Kit

EH4701 96T
EUR 567.6
  • Detection range: 7.813-500 pg/ml
  • Uniprot ID: P10636
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 4.688pg/ml

Human phospho Tau Protein ELISA kit

ELA-E1984h 96 Tests
EUR 824

Human MEK Kinase Kinase 2 (MAP4K2) ELISA Kit

abx388410-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

TTBK2 ORF Vector (Human) (pORF)

ORF011086 1.0 ug DNA
EUR 95

Tau-Protein Kinase 1 (tPK1) Antibody

20-abx131659
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Tau-Protein Kinase 1 (TPK1) Antibody

abx145300-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Tau-Protein Kinase 1 (tPK1) Antibody

20-abx174721
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tau-Protein Kinase 1 (TPK1) Antibody

abx238888-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Tau-Protein Kinase 1 (tPK1)

4-RPB984Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5TCY1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 61.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Tau-Protein Kinase 1 expressed in: E.coli

Human Tubulin Beta (TUBB) ELISA Kit

abx570283-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Tubulin Alpha 3c ELISA kit

E01T0366-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tubulin Alpha 3c ELISA kit

E01T0366-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tubulin Alpha 3c ELISA kit

E01T0366-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Acetylated tubulin Lys40 ELISA KIT|Human

EF007566 96 Tests
EUR 689

Human β-tubulin(TUBB)ELISA Kit

GA-E1625HM-48T 48T
EUR 289

Human β-tubulin(TUBB)ELISA Kit

GA-E1625HM-96T 96T
EUR 466

Human Tubulin Beta (TUBB) ELISA Kit

abx251297-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Tubulin Beta (TUBb) ELISA Kit

DLR-TUBb-Hu-48T 48T
EUR 498
  • Should the Human Tubulin Beta (TUBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Beta (TUBb) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Tubulin Beta (TUBb) ELISA Kit

DLR-TUBb-Hu-96T 96T
EUR 647
  • Should the Human Tubulin Beta (TUBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Beta (TUBb) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

ELISA kit for Human TUB? (?-Tubulin)

E-EL-H1006 1 plate of 96 wells
EUR 534
  • Gentaur's TUB? ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TUB?. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TUB? (?-Tubulin) in samples from Serum, Plasma, Cell supernatant

Human Tubulin Beta (TUBb) ELISA Kit

RDR-TUBb-Hu-48Tests 48 Tests
EUR 522

Human Tubulin Beta (TUBb) ELISA Kit

RDR-TUBb-Hu-96Tests 96 Tests
EUR 724

Human Tubulin Beta (TUBb) ELISA Kit

RD-TUBb-Hu-48Tests 48 Tests
EUR 500

Human Tubulin Beta (TUBb) ELISA Kit

RD-TUBb-Hu-96Tests 96 Tests
EUR 692

Human Tubulin Epsilon(TUBe)ELISA Kit

QY-E01093 96T
EUR 361

Human Tubulin Delta(TUBd)ELISA Kit

QY-E01094 96T
EUR 361

Human Tubulin Beta(TUBb)ELISA Kit

QY-E01101 96T
EUR 361

Human β-tubulin(TUBB)ELISA Kit

QY-E04395 96T
EUR 361

ELISA kit for Human MAP? (Microtubule Associated Protein Tau/Tau Protein)

E-EL-H0948 1 plate of 96 wells
EUR 534
  • Gentaur's MAP? ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MAP?. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MAP? (Microtubule Associated Protein Tau/Tau Protein) in samples from Serum, Plasma, Cell supernatant

Bovine IFN Tau(IFN Tau)ELISA

QY-E60043 96T
EUR 426

Microtubule Associated Protein Tau / Tau Protein (MAPT) ELISA Kit

abx595582-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Tau-Protein Kinase 1 (tPK1) Polyclonal Antibody (Human)

4-PAB984Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: tPK1 (Trp34~Arg300)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Protein Kinase 1 (tPK1)

Human tyrosine kinase 2 ELISA Kit

ELA-E1595h 96 Tests
EUR 824

Human RIO kinase 2 ELISA Kit

ELA-E2243h 96 Tests
EUR 824

Ttbk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4076703 1.0 ug DNA
EUR 154

Ttbk2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6215403 1.0 ug DNA
EUR 154

Bovine Tubulin gamma- 2 chain, TUBG2 ELISA KIT

ELI-13734b 96 Tests
EUR 928

Mouse Tubulin gamma- 2 chain, Tubg2 ELISA KIT

ELI-46474m 96 Tests
EUR 865

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Tau (Tau 46)

MO18002 100 ul
EUR 483

Tau (pS214) Cell ELISA Kit

abx596057-296tests 2 × 96 tests
EUR 707
  • Shipped within 1-2 weeks.

Tau (pS262) Cell ELISA Kit

abx596058-296tests 2 × 96 tests
EUR 707
  • Shipped within 1-2 weeks.

Tau (pS356) Cell ELISA Kit

abx596059-296tests 2 × 96 tests
EUR 707
  • Shipped within 1-2 weeks.

Tau (pS396) Cell ELISA Kit

abx596060-296tests 2 × 96 tests
EUR 707
  • Shipped within 1-2 weeks.

Mouse Tau Protein ELISA kit

E03T0024-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tau Protein ELISA kit

E03T0024-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tau Protein ELISA kit

E03T0024-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tau Protein ELISA kit

E02T0024-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tau Protein ELISA kit

E02T0024-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tau Protein ELISA kit

E02T0024-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tau Protein ELISA kit

E04T0024-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tau Protein ELISA kit

E04T0024-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tau Protein ELISA kit

E04T0024-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tau Protein ELISA kit

E06T0024-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tau Protein ELISA kit

E06T0024-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tau Protein ELISA kit

E06T0024-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine IFN- tau ELISA Kit

ELA-E2106b 96 Tests
EUR 928

Guinea Pig Tau ELISA Kit

EGT0031 96Tests
EUR 521

Dog Tau Protein ELISA kit

E08T0024-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tau Protein ELISA kit

E08T0024-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tau Protein ELISA kit

E08T0024-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tau Protein ELISA kit

E07T0024-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tau Protein ELISA kit

E07T0024-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tau Protein ELISA kit

E07T0024-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tau Protein ELISA kit

E09T0024-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.