Human tTBK2(Tau-Tubulin Kinase 2) ELISA Kit

Human tTBK2(Tau-Tubulin Kinase 2) ELISA Kit

To Order Contact us: 

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit
RD-tTBK2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Tau- tubulin kinase 2, TTBK2 ELISA KIT
ELI-40059h	Lifescience Market	96 Tests	EUR 824

Human Tau-Tubulin Kinase 2(tTBK2)ELISA Kit
QY-E04375	Qayee Biotechnology	96T	EUR 400

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit
SEE723Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit
SEE723Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit
SEE723Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit
SEE723Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Tubulin Kinase 2 (tTBK2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in Tissue homogenates, cell lysates and other biological fluids.

Human Tau-Tubulin Kinase 2 (tTBK2) ELISA Kit
4-SEE723Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tau-Tubulin Kinase 2 elisa. Alternative names of the recognized antigen: SCA11 Spinocerebellar Ataxia 11
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tau-Tubulin Kinase 2 (tTBK2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Tau-Tubulin Kinase 2 (tTBK2) Antibody
20-abx129224	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tau Tubulin Kinase 2 (TTBK2) Antibody
20-abx006182	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tau Tubulin Kinase 2 (TTBK2) Antibody
20-abx003961	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Tau Tubulin Kinase 2 (TTBK2) Antibody
abx026626-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tau Tubulin Kinase 2 (TTBK2) Antibody
abx026626-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tau-Tubulin Kinase 2 (tTBK2) Antibody
20-abx174723	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Tau Tubulin Kinase 2 (TTBK2) Antibody
20-abx320391	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Tau Tubulin Kinase 2 (TTBK2) Antibody
abx239076-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Tau-Tubulin Kinase 2 (TTBK2) Antibody
20-abx212443	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Tau-Tubulin Kinase 2 (TTBK2) Antibody
20-abx212444	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Tau-Tubulin Kinase 2 (tTBK2)
4-RPE723Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q6IQ55 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 63.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Tau-Tubulin Kinase 2 expressed in: E.coli

Mouse Tau- tubulin kinase 2, Ttbk2 ELISA KIT
ELI-23115m	Lifescience Market	96 Tests	EUR 865

Human Tau-Tubulin Kinase 2 (tTBK2) Protein
20-abx168270	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Tau-Tubulin Kinase 2 (tTBK2) CLIA Kit
20-abx494710	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human tTBK2 (Tau-Tubulin Kinase 2)
ELK4778	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tau-Tubulin Kinase 2 (tTBK2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tau-T Show more
Description: A sandwich ELISA kit for detection of Tau-Tubulin Kinase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Tau-tubulin kinase 2 (TTBK2)
KTE60120-48T	Abbkine	48T	EUR 332
TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o Show more
Description: Quantitative sandwich ELISA for measuring Human Tau-tubulin kinase 2 (TTBK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tau-tubulin kinase 2 (TTBK2)
KTE60120-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o Show more
Description: Quantitative sandwich ELISA for measuring Human Tau-tubulin kinase 2 (TTBK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tau-tubulin kinase 2 (TTBK2)
KTE60120-96T	Abbkine	96T	EUR 539
TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o Show more
Description: Quantitative sandwich ELISA for measuring Human Tau-tubulin kinase 2 (TTBK2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human)
4-PAE723Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: tTBK2 (Trp21~Thr314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2)

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), APC
4-PAE723Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: tTBK2 (Trp21~Thr314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with APC.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), Biotinylated
4-PAE723Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: tTBK2 (Trp21~Thr314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with Biotin.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), Cy3
4-PAE723Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: tTBK2 (Trp21~Thr314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with Cy3.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), FITC
4-PAE723Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: tTBK2 (Trp21~Thr314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with FITC.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), HRP
4-PAE723Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: tTBK2 (Trp21~Thr314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with HRP.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), PE
4-PAE723Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: tTBK2 (Trp21~Thr314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with PE.

Tau-Tubulin Kinase 2 (tTBK2) Polyclonal Antibody (Human), APC-Cy7
4-PAE723Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: tTBK2 (Trp21~Thr314) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Tubulin Kinase 2 (tTBK2). This antibody is labeled with APC-Cy7.

Human Tau-Tubulin Kinase 2 (SCA11) ELISA Kit
20-abx153233	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Tau Tubulin Kinase 2 Antibody
20-abx115998	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

anti-Tau tubulin kinase 2
YF-PA22380	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Tau tubulin kinase 2

Human Tau- tubulin kinase 1, TTBK1 ELISA KIT
ELI-40058h	Lifescience Market	96 Tests	EUR 824

Recombinant human Tau-tubulin kinase 1
P2423	FN Test	100ug	Ask for price
Uniprot ID: Q5TCY1 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Tau-tubulin kinase 1

Mouse Tau- tubulin kinase 1, Ttbk1 ELISA KIT
ELI-16658m	Lifescience Market	96 Tests	EUR 865

Tau Tubulin Kinase 1 (TTBK1) Antibody
abx031335-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tau Tubulin Kinase 1 (TTBK1) Antibody
abx031335-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tau Tubulin Kinase 1 (TTBK1) Antibody
20-abx210738	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ELISA kit for Mouse Tau-tubulin kinase 1 (TTBK1)
KTE70049-48T	Abbkine	48T	EUR 332
TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tau-tubulin kinase 1 (TTBK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tau-tubulin kinase 1 (TTBK1)
KTE70049-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tau-tubulin kinase 1 (TTBK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tau-tubulin kinase 1 (TTBK1)
KTE70049-96T	Abbkine	96T	EUR 539
TTBK2 produces a 5.6-kb transcript in which the longest open reading frame is 3,732 nucleotides, encoding a protein of 1,244 amino acids. The gene is alternatively spliced, with ubiquitous expression in human adult and fetal tissues. The N-terminus o Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tau-tubulin kinase 1 (TTBK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TTBK2 ELISA KIT|Human
EF003916	Lifescience Market	96 Tests	EUR 689

Human τPK1(Tau-Protein Kinase) ELISA Kit
EH4001	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q9H3S4 Alias: τPK1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Tau-Protein Kinase 1 (TPK1) ELISA Kit
20-abx153232	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tau-Protein Kinase 1 (TPK1) ELISA Kit
abx358325-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Tau-Protein Kinase 1 (TTBK1) ELISA Kit
abx253405-96tests	Abbexa	96 tests	EUR 637
Shipped within 5-12 working days.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit
DLR-tPK1-Hu-48T	DL Develop	48T	EUR 498
Should the Human Tau-Protein Kinase 1 (tPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tau-Protein Kinase 1 (tPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit
DLR-tPK1-Hu-96T	DL Develop	96T	EUR 647
Should the Human Tau-Protein Kinase 1 (tPK1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tau-Protein Kinase 1 (tPK1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit
SEB984Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4502.43
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit
SEB984Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 458.44
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit
SEB984Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 612.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit
SEB984Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2454.23
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tau-Protein Kinase 1 (tPK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tau-Protein Kinase 1 (tPK1) in tissue homogenates, cell lysates and other biological fluids.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit
4-SEB984Hu	Cloud-Clone	EUR 4553.00 EUR 2405.00 EUR 613.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tau-Protein Kinase 1 elisa. Alternative names of the recognized antigen: TTBK1 BDTK TTK Cdk5/P20 CDK5/P23 GSK STK31 Brain-derived tau kinase Tau-Tubulin Kinase 1 Tau-Protein O-Hosphotransferase Brain Protein Kinase PK40erk
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tau-Protein Kinase 1 (tPK1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit
RDR-tPK1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit
RDR-tPK1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Tau-Protein Kinase 1 ELISA Kit (tPK1)
RK02434	Abclonal	96 Tests	EUR 521

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit
RD-tPK1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Tau-Protein Kinase 1 (tPK1) ELISA Kit
RD-tPK1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Tau-Protein Kinase 1(tPK1)ELISA Kit
QY-E04376	Qayee Biotechnology	96T	EUR 400

Human Tau-Protein Kinase (τPK1) CLIA Kit
20-abx493333	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Tau-Protein Kinase (τPK1) CLIA Kit
abx197758-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

ELISA kit for Human tPK1 (Tau-Protein Kinase 1)
ELK2730	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tau-Protein Kinase 1 (tPK1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tau-Pr Show more
Description: A sandwich ELISA kit for detection of Tau-Protein Kinase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human ?PK1 (Tau-Protein Kinase 1)
E-EL-H1550	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's ?PK1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human ?PK1. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human ?PK1 (Tau-Protein Kinase 1) in samples from Serum, Plasma, Cell supernatant

Human Tau ELISA Kit
EHT0031	Abclonal	96Tests	EUR 521

Human gamma Tubulin (gamma Tubulin) ELISA Kit
abx259584-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Anti- Beta-tubulin Monoclonal Antibody
M05613-2	BosterBio	100ul	EUR 397
Description: Mouse Monoclonal Beta-tubulin Antibody. Validated in IF, IHC, WB and tested in Human, Monkey, Mouse, Rat.

Human Tubulin Gamma 2(TUBg2)ELISA Kit
QY-E01095	Qayee Biotechnology	96T	EUR 361

Pig Tau-Protein Kinase 1 (TTBK1) ELISA Kit
abx360764-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Tau-Protein Kinase 1 (TTBK1) ELISA Kit
abx363709-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Tau-Protein Kinase 1 (TTBK1) ELISA Kit
abx364420-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Monkey Tau-Protein Kinase 1 (TTBK1) ELISA Kit
abx359053-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Tau-Protein Kinase 1 (TTBK1) ELISA Kit
abx355866-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

TTBK2 siRNA
20-abx938412	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TTBK2 siRNA
20-abx938413	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TTBK2 antibody
70R-21044	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TTBK2 antibody

Ttbk2 antibody
70R-8045	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal Ttbk2 antibody

TTBK2 Antibody
ABD2688	Lifescience Market	100 ug	EUR 438

TTBK2 Antibody
43172-100ul	SAB	100ul	EUR 252

TTBK2 Antibody
25447-100ul	SAB	100ul	EUR 390

TTBK2 Antibody
1-CSB-PA930884	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TTBK2 Antibody
DF2688	Affbiotech	200ul	EUR 304
Description: TTBK2 antibody detects endogenous levels of total TTBK2.

TTBK2 Antibody
1-CSB-PA753711DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TTBK2 Antibody
1-CSB-PA224049	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

TTBK2 Antibody
1-CSB-PA025202GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TTBK2. Recognizes TTBK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Anti-Phospho-Tau (S396) Rabbit Monoclonal Antibody
P00097-2	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal Phospho-Tau (S396) Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

TTBK2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2546703	ABM	1.0 ug DNA	EUR 154

Human Tau Protein ELISA kit
E01T0024-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tau Protein ELISA kit
E01T0024-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tau Protein ELISA kit
E01T0024-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Tau / MAPT (Human) ELISA Kit
K4263-100	Biovision		EUR 805

Human Tau proteins ELISA kit
CSB-E12011h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tau proteins in samples from serum, plasma, cerebrospinalfluid (CSF). A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tau proteins ELISA kit
1-CSB-E12011h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tau proteins in samples from serum, plasma, cerebrospinalfluid(CSF). Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human TTBK2 shRNA Plasmid
20-abx965454	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Tubulin gamma- 2 chain, TUBG2 ELISA KIT
ELI-29149h	Lifescience Market	96 Tests	EUR 824

MAPT 412a.a. Microtubule-Associated Protein Tau 412 a.a. Human Recombinant Protein
PROTP10636-2	BosterBio	Regular: 5ug	EUR 317
Description: MAPT Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 432 amino acids (1-412 a.a.) and having a molecular mass of 45.1kDa (Molecular size on SDS-PAGE will appear higher). The MAPT is purified by proprietary chromatographic techniques.

Human β tubulin ELISA kit
E01T0555-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β tubulin ELISA kit
E01T0555-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β tubulin ELISA kit
E01T0555-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β tubulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Tubulin-beta ELISA KIT|Human
EF003944	Lifescience Market	96 Tests	EUR 689

gamma Tubulin ELISA KIT|Human
EF009775	Lifescience Market	96 Tests	EUR 689

alpha Tubulin ELISA KIT|Human
EF007730	Lifescience Market	96 Tests	EUR 689

human ?-tubulin,TUBB ELISA kit
201-12-1609	SunredBio	96 tests	EUR 440
This ?-tubulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Anti-Tau Antibody (monoclonal, TAU-2)
MA1093	BosterBio	100ug/vial	EUR 334

Bovine Interferon tau- 2, IFNT2 ELISA KIT
ELI-20137b	Lifescience Market	96 Tests	EUR 928

CLIA kit for Human ?PK1 (Tau-Protein Kinase 1)
E-CL-H0994	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's ?PK1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human ?PK1 . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human ?PK1 (Tau-Protein Kinase 1) in samples from Serum, Plasma, Cell supernatant

Human Tau-Protein Kinase 1 (tPK1) Protein
20-abx168803	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Anti- alpha -Tubulin Rabbit Monoclonal Antibody, Clone#RM113
M08382-2	BosterBio	100uL	EUR 397
Description: Anti- alpha -Tubulin Rabbit Monoclonal Antibody, Clone#RM113 tested in WB, IP, ICC, IHC, FC, ELISA , reactive to All Species

Taurine (Tau) ELISA Kit
20-abx585011	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Goat Tau ELISA Kit
EGTT0031	Abclonal	96Tests	EUR 521

Bovine Tau ELISA Kit
EBT0031	Abclonal	96Tests	EUR 521

Chicken Tau ELISA Kit
ECKT0031	Abclonal	96Tests	EUR 521

Anserini Tau ELISA Kit
EAT0031	Abclonal	96Tests	EUR 521

Canine Tau ELISA Kit
ECT0031	Abclonal	96Tests	EUR 521

Porcine Tau ELISA Kit
EPT0031	Abclonal	96Tests	EUR 521

Rat Tau ELISA Kit
ERT0031	Abclonal	96Tests	EUR 521

Sheep Tau ELISA Kit
EST0031	Abclonal	96Tests	EUR 521

Rabbit Tau ELISA Kit
ERTT0031	Abclonal	96Tests	EUR 521

Monkey Tau ELISA Kit
EMKT0031	Abclonal	96Tests	EUR 521

Mouse Tau ELISA Kit
EMT0031	Abclonal	96Tests	EUR 521

Rat(TAU) ELISA Kit
QY-E11751	Qayee Biotechnology	96T	EUR 374

Human Microtubule Associated Protein Tau/Tau Protein (MAPT) ELISA Kit
20-abx152272	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Microtubule Associated Protein Tau/Tau Protein (MAPT) ELISA Kit
abx251357-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Anti-Rsk 2/MAPKAP Kinase 1b/RPS6KA3 Antibody
A02215-2	BosterBio	100ug/vial	EUR 334

TTBK2 Conjugated Antibody
C43172	SAB	100ul	EUR 397

Polyclonal TTBK2 Antibody
APR13842G	Leading Biology	0.1 mg	EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TTBK2 . This antibody is tested and proven to work in the following applications:

anti- TTBK2 antibody
FNab09076	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: tau tubulin kinase 2 Uniprot ID: Q6IQ55 Gene ID: 146057 Research Area: Neuroscience, Cell Division and Proliferation, Metabolism
Description: Antibody raised against TTBK2

TTBK2 Rabbit pAb
A5168-100ul	Abclonal	100 ul	EUR 308

TTBK2 Rabbit pAb
A5168-200ul	Abclonal	200 ul	EUR 459

TTBK2 Rabbit pAb
A5168-20ul	Abclonal	20 ul	Ask for price

TTBK2 Rabbit pAb
A5168-50ul	Abclonal	50 ul	Ask for price

TTBK2 Rabbit pAb
A13448-100ul	Abclonal	100 ul	EUR 308

TTBK2 Rabbit pAb
A13448-200ul	Abclonal	200 ul	EUR 459

TTBK2 Rabbit pAb
A13448-20ul	Abclonal	20 ul	EUR 183

TTBK2 Rabbit pAb
A13448-50ul	Abclonal	50 ul	EUR 223

TTBK2 Rabbit pAb
A7609-100ul	Abclonal	100 ul	EUR 308

TTBK2 Rabbit pAb
A7609-200ul	Abclonal	200 ul	EUR 459

TTBK2 Rabbit pAb
A7609-20ul	Abclonal	20 ul	EUR 183

TTBK2 Rabbit pAb
A7609-50ul	Abclonal	50 ul	EUR 223

Ttbk2 Blocking Peptide
33R-4581	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Ttbk2 antibody, catalog no. 70R-8045

TTBK2 Blocking Peptide
DF2688-BP	Affbiotech	1mg	EUR 195

TTBK2 cloning plasmid
CSB-CL753711HU-10ug	Cusabio	10ug	EUR 1316
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3735 Sequence: atgagtgggggaggagagcagccggatatcctgagtgttggaatcctagtgaaagaaagatggaaagtgttgagaaagattgggggtgggggctttggagaaatttacgatgccttggacatgctcaccagggaaaatgttgcactgaaggtggaatcagctcaacaaccaaaac Show more
Description: A cloning plasmid for the TTBK2 gene.

Anti-TTBK2 antibody
PAab09076	Lifescience Market	100 ug	EUR 386

Anti-TTBK2 antibody
STJ29746	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem.

Anti-TTBK2 antibody
STJ27147	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem.

Anti-TTBK2 antibody
STJ115409	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem.

Human Gamma- tubulin complex component 2, TUBGCP2 ELISA KIT
ELI-08158h	Lifescience Market	96 Tests	EUR 824

Human Phosphorylated tau 231 ELISA kit
E01P0580-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 231 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphorylated tau 231 ELISA kit
E01P0580-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 231 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphorylated tau 231 ELISA kit
E01P0580-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 231 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphorylated tau 181 ELISA kit
E01P0581-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 181 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphorylated tau 181 ELISA kit
E01P0581-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 181 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phosphorylated tau 181 ELISA kit
E01P0581-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Phosphorylated tau 181 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Phospho Tau (P181) ELISA Kit
EH4701	FN Test	96T	EUR 567.6
Detection range: 7.813-500 pg/ml Uniprot ID: P10636
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 4.688pg/ml

Human phospho Tau Protein ELISA kit
ELA-E1984h	Lifescience Market	96 Tests	EUR 824

Human MEK Kinase Kinase 2 (MAP4K2) ELISA Kit
abx388410-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

TTBK2 ORF Vector (Human) (pORF)
ORF011086	ABM	1.0 ug DNA	EUR 95

Tau-Protein Kinase 1 (tPK1) Antibody
20-abx131659	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Tau-Protein Kinase 1 (TPK1) Antibody
abx145300-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tau-Protein Kinase 1 (tPK1) Antibody
20-abx174721	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Tau-Protein Kinase 1 (TPK1) Antibody
abx238888-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Tau-Protein Kinase 1 (tPK1)
4-RPB984Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q5TCY1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 61.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Tau-Protein Kinase 1 expressed in: E.coli

Human Tubulin Beta (TUBB) ELISA Kit
abx570283-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Tubulin Alpha 3c ELISA kit
E01T0366-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tubulin Alpha 3c ELISA kit
E01T0366-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tubulin Alpha 3c ELISA kit
E01T0366-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Tubulin Alpha 3c in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Acetylated tubulin Lys40 ELISA KIT|Human
EF007566	Lifescience Market	96 Tests	EUR 689

Human β-tubulin(TUBB)ELISA Kit
GA-E1625HM-48T	GenAsia Biotech	48T	EUR 289

Human β-tubulin(TUBB)ELISA Kit
GA-E1625HM-96T	GenAsia Biotech	96T	EUR 466

Human Tubulin Beta (TUBB) ELISA Kit
abx251297-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Tubulin Beta (TUBb) ELISA Kit
DLR-TUBb-Hu-48T	DL Develop	48T	EUR 498
Should the Human Tubulin Beta (TUBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Beta (TUBb) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Tubulin Beta (TUBb) ELISA Kit
DLR-TUBb-Hu-96T	DL Develop	96T	EUR 647
Should the Human Tubulin Beta (TUBb) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Tubulin Beta (TUBb) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

ELISA kit for Human TUB? (?-Tubulin)
E-EL-H1006	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's TUB? ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human TUB?. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human TUB? (?-Tubulin) in samples from Serum, Plasma, Cell supernatant

Human Tubulin Beta (TUBb) ELISA Kit
RDR-TUBb-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Tubulin Beta (TUBb) ELISA Kit
RDR-TUBb-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Human Tubulin Beta (TUBb) ELISA Kit
RD-TUBb-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Tubulin Beta (TUBb) ELISA Kit
RD-TUBb-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Tubulin Epsilon(TUBe)ELISA Kit
QY-E01093	Qayee Biotechnology	96T	EUR 361

Human Tubulin Delta(TUBd)ELISA Kit
QY-E01094	Qayee Biotechnology	96T	EUR 361

Human Tubulin Beta(TUBb)ELISA Kit
QY-E01101	Qayee Biotechnology	96T	EUR 361

Human β-tubulin(TUBB)ELISA Kit
QY-E04395	Qayee Biotechnology	96T	EUR 361

ELISA kit for Human MAP? (Microtubule Associated Protein Tau/Tau Protein)
E-EL-H0948	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's MAP? ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MAP?. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MAP? (Microtubule Associated Protein Tau/Tau Protein) in samples from Serum, Plasma, Cell supernatant

Bovine IFN Tau(IFN Tau)ELISA
QY-E60043	Qayee Biotechnology	96T	EUR 426

Microtubule Associated Protein Tau / Tau Protein (MAPT) ELISA Kit
abx595582-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Tau-Protein Kinase 1 (tPK1) Polyclonal Antibody (Human)
4-PAB984Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: tPK1 (Trp34~Arg300) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Tau-Protein Kinase 1 (tPK1)

Human tyrosine kinase 2 ELISA Kit
ELA-E1595h	Lifescience Market	96 Tests	EUR 824

Human RIO kinase 2 ELISA Kit
ELA-E2243h	Lifescience Market	96 Tests	EUR 824

Ttbk2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4076703	ABM	1.0 ug DNA	EUR 154

Ttbk2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6215403	ABM	1.0 ug DNA	EUR 154

Bovine Tubulin gamma- 2 chain, TUBG2 ELISA KIT
ELI-13734b	Lifescience Market	96 Tests	EUR 928

Mouse Tubulin gamma- 2 chain, Tubg2 ELISA KIT
ELI-46474m	Lifescience Market	96 Tests	EUR 865

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Tau (Tau 46)
MO18002	Neuromics	100 ul	EUR 483

Tau (pS214) Cell ELISA Kit
abx596057-296tests	Abbexa	2 × 96 tests	EUR 707
Shipped within 1-2 weeks.

Tau (pS262) Cell ELISA Kit
abx596058-296tests	Abbexa	2 × 96 tests	EUR 707
Shipped within 1-2 weeks.

Tau (pS356) Cell ELISA Kit
abx596059-296tests	Abbexa	2 × 96 tests	EUR 707
Shipped within 1-2 weeks.

Tau (pS396) Cell ELISA Kit
abx596060-296tests	Abbexa	2 × 96 tests	EUR 707
Shipped within 1-2 weeks.

Mouse Tau Protein ELISA kit
E03T0024-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tau Protein ELISA kit
E03T0024-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tau Protein ELISA kit
E03T0024-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tau Protein ELISA kit
E02T0024-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tau Protein ELISA kit
E02T0024-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tau Protein ELISA kit
E02T0024-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tau Protein ELISA kit
E04T0024-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tau Protein ELISA kit
E04T0024-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tau Protein ELISA kit
E04T0024-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tau Protein ELISA kit
E06T0024-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tau Protein ELISA kit
E06T0024-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tau Protein ELISA kit
E06T0024-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine IFN- tau ELISA Kit
ELA-E2106b	Lifescience Market	96 Tests	EUR 928

Guinea Pig Tau ELISA Kit
EGT0031	Abclonal	96Tests	EUR 521

Dog Tau Protein ELISA kit
E08T0024-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tau Protein ELISA kit
E08T0024-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tau Protein ELISA kit
E08T0024-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tau Protein ELISA kit
E07T0024-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tau Protein ELISA kit
E07T0024-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tau Protein ELISA kit
E07T0024-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tau Protein ELISA kit
E09T0024-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Tau Protein in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.