Human SRI(Sorcin) ELISA Kit

Human SRI(Sorcin) ELISA Kit

To Order Contact us: 

Human Sorcin (SRI) ELISA Kit
20-abx156780	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human SRI/ Sorcin ELISA Kit
E2391Hu	Sunlong	1 Kit	EUR 605

Human Sorcin, SRI ELISA KIT
ELI-30055h	Lifescience Market	96 Tests	EUR 824

Human Sorcin (SRI) ELISA Kit
abx555504-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Sorcin(SRI)ELISA Kit
QY-E02519	Qayee Biotechnology	96T	EUR 361

Human Sorcin (SRI) ELISA Kit
SEH133Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

Human Sorcin (SRI) ELISA Kit
SEH133Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

Human Sorcin (SRI) ELISA Kit
SEH133Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

Human Sorcin (SRI) ELISA Kit
SEH133Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

Human Sorcin (SRI) ELISA Kit
4-SEH133Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sorcin elisa. Alternative names of the recognized antigen: SCN CP-22 V19 22 kDa protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sorcin (SRI) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Sri/ Sorcin ELISA Kit
E1413Mo	Sunlong	1 Kit	EUR 632

Mouse Sorcin, Sri ELISA KIT
ELI-53405m	Lifescience Market	96 Tests	EUR 865

Mouse Sorcin (SRI) ELISA Kit
abx555639-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Sorcin (SRI) Antibody
20-abx006837	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sorcin (SRI) Antibody
20-abx115730	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Sorcin (SRI) Antibody
20-abx131566	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Sorcin (SRI) Antibody
20-abx141905	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Sorcin (SRI) Antibody
20-abx174604	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Sorcin (SRI) Protein
20-abx261147	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Sorcin (SRI) Antibody
abx238228-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Sorcin (SRI) Antibody
20-abx322137	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Sorcin (SRI)
4-RPH133Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P30626 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Sorcin expressed in: E.coli

ELISA kit for Human SRI (Sorcin)
ELK5034	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sorcin (SRI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sorcin (SRI). Next, A Show more
Description: A sandwich ELISA kit for detection of Sorcin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Sorcin (SRI)
KTE60358-48T	Abbkine	48T	EUR 332
The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th Show more
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sorcin (SRI)
KTE60358-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th Show more
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Sorcin (SRI)
KTE60358-96T	Abbkine	96T	EUR 539
The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th Show more
Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Sorcin (SRI) CLIA Kit
20-abx495378	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Sorcin (SRI) Protein
20-abx650707	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse Sorcin (SRI)
KTE70255-48T	Abbkine	48T	EUR 332
Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sorcin (SRI)
KTE70255-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Sorcin (SRI)
KTE70255-96T	Abbkine	96T	EUR 539
Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal Show more
Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sri ELISA Kit| Mouse Sorcin ELISA Kit
EF016248	Lifescience Market	96 Tests	EUR 689

Sorcin (SRI) Polyclonal Antibody (Human)
4-PAH133Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRI (Gly29~Leu169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI)

SRI Sorcin Human Recombinant Protein
PROTP30626	BosterBio	Regular: 20ug	EUR 317
Description: SRI Human Recombinant fused with a 23 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 221 amino acids (1-198 a.a.) and having a molecular mass of 24.1kDa. The SRI is purified by proprietary chromatographic techniques.

Sorcin (SRI) Polyclonal Antibody (Human), APC
4-PAH133Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRI (Gly29~Leu169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with APC.

Sorcin (SRI) Polyclonal Antibody (Human), Biotinylated
4-PAH133Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRI (Gly29~Leu169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with Biotin.

Sorcin (SRI) Polyclonal Antibody (Human), Cy3
4-PAH133Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRI (Gly29~Leu169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with Cy3.

Sorcin (SRI) Polyclonal Antibody (Human), FITC
4-PAH133Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRI (Gly29~Leu169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with FITC.

Sorcin (SRI) Polyclonal Antibody (Human), HRP
4-PAH133Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRI (Gly29~Leu169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with HRP.

Sorcin (SRI) Polyclonal Antibody (Human), PE
4-PAH133Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRI (Gly29~Leu169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with PE.

Sorcin (SRI) Polyclonal Antibody (Human), APC-Cy7
4-PAH133Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SRI (Gly29~Leu169) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with APC-Cy7.

Polyclonal SRI / Sorcin Antibody (aa50-100)
APR02437G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRI / Sorcin (aa50-100). This antibody is tested and proven to work in the following applications:

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-100ug
QP6727-ec-100ug	EnQuireBio	100ug	EUR 408

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-10ug
QP6727-ec-10ug	EnQuireBio	10ug	EUR 200

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-1mg
QP6727-ec-1mg	EnQuireBio	1mg	EUR 1632

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-200ug
QP6727-ec-200ug	EnQuireBio	200ug	EUR 634

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-500ug
QP6727-ec-500ug	EnQuireBio	500ug	EUR 1060

Recombinant Human SRI/ Sorcin Protein, GST, E.coli-50ug
QP6727-ec-50ug	EnQuireBio	50ug	EUR 263

SRI ELISA KIT|Human
EF003232	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Sorcin
EK3730	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sorcin in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse Sorcin
EK3729	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Sorcin in samples from serum, plasma, tissue homogenates and other biological fluids.

Recombinant Human Sorcin
7-06526	CHI Scientific	5µg	Ask for price

Recombinant Human Sorcin
7-06527	CHI Scientific	20µg	Ask for price

Recombinant Human Sorcin
7-06528	CHI Scientific	1mg	Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

SRI antibody
70R-20520	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal SRI antibody

SRI Antibody
1-CSB-PA022665ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SRI. Recognizes SRI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

SRI Antibody
1-CSB-PA022665GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SRI. Recognizes SRI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SRI siRNA
20-abx935158	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SRI siRNA
20-abx935159	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human SRI shRNA Plasmid
20-abx954586	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SRI Recombinant Protein (Human)
RP030076	ABM	100 ug	Ask for price

SRI Polyclonal Antibody
42331-100ul	SAB	100ul	EUR 333

Anti-SRI Antibody
A00222	BosterBio	100ug/vial	EUR 334

SRI cloning plasmid
CSB-CL022665HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 597 Sequence: atggcgtacccggggcatcctggcgccggcggcgggtactacccaggcgggtatggaggggctcccggagggcctgcgtttcccggacaaactcaggatccgctgtatggttactttgctgctgtagctggacaggatgggcagatagatgctgatgaattgcagagatgtctgac Show more
Description: A cloning plasmid for the SRI gene.

SRI Rabbit pAb
A6751-100ul	Abclonal	100 ul	EUR 308

SRI Rabbit pAb
A6751-200ul	Abclonal	200 ul	EUR 459

SRI Rabbit pAb
A6751-20ul	Abclonal	20 ul	EUR 183

SRI Rabbit pAb
A6751-50ul	Abclonal	50 ul	EUR 223

anti- SRI antibody
FNab08228	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: sorcin Uniprot ID: P30626 Gene ID: 6717 Research Area: Neuroscience, Cardiovascular, Signal Transduction
Description: Antibody raised against SRI

SRI-011381 (hydrochloride)
HY-100347A	MedChemExpress	50mg	EUR 1097

SRI 31215 (TFA)
HY-114363A	MedChemExpress	100mg	EUR 1887

Anti-SRI antibody
PAab08228	Lifescience Market	100 ug	EUR 386

Anti-SRI antibody
STJ11100797	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene.

Anti-SRI antibody
STJ28834	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene.

SRI ORF Vector (Human) (pORF)
ORF010026	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

SRI protein (His tag)
80R-1699	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human SRI protein

SRI Polyclonal Conjugated Antibody
C42331	SAB	100ul	EUR 397

Mouse SRI shRNA Plasmid
20-abx980002	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SRI Recombinant Protein (Rat)
RP231044	ABM	100 ug	Ask for price

Anti-SR1/SRI Antibody
RP1110	BosterBio	100ug/vial	EUR 294

SRI Recombinant Protein (Mouse)
RP175409	ABM	100 ug	Ask for price

SRI Recombinant Protein (Mouse)
RP175412	ABM	100 ug	Ask for price

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

SRI sgRNA CRISPR Lentivector set (Human)
K2285001	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

[KO Validated] SRI Rabbit pAb
A19921-100ul	Abclonal	100 ul	EUR 410

[KO Validated] SRI Rabbit pAb
A19921-200ul	Abclonal	200 ul	EUR 571

[KO Validated] SRI Rabbit pAb
A19921-20ul	Abclonal	20 ul	EUR 221

[KO Validated] SRI Rabbit pAb
A19921-50ul	Abclonal	50 ul	EUR 287

Sri ORF Vector (Rat) (pORF)
ORF077016	ABM	1.0 ug DNA	EUR 506

Sri ORF Vector (Mouse) (pORF)
ORF058471	ABM	1.0 ug DNA	EUR 506

Sri ORF Vector (Mouse) (pORF)
ORF058472	ABM	1.0 ug DNA	EUR 506

SRI sgRNA CRISPR Lentivector (Human) (Target 1)
K2285002	ABM	1.0 ug DNA	EUR 154

SRI sgRNA CRISPR Lentivector (Human) (Target 2)
K2285003	ABM	1.0 ug DNA	EUR 154

SRI sgRNA CRISPR Lentivector (Human) (Target 3)
K2285004	ABM	1.0 ug DNA	EUR 154

SRI Protein Vector (Human) (pPB-C-His)
PV040101	ABM	500 ng	EUR 329

SRI Protein Vector (Human) (pPB-N-His)
PV040102	ABM	500 ng	EUR 329

SRI Protein Vector (Human) (pPM-C-HA)
PV040103	ABM	500 ng	EUR 329

SRI Protein Vector (Human) (pPM-C-His)
PV040104	ABM	500 ng	EUR 329

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

Sri sgRNA CRISPR Lentivector set (Rat)
K7508101	ABM	3 x 1.0 ug	EUR 339

Sri sgRNA CRISPR Lentivector set (Mouse)
K3050701	ABM	3 x 1.0 ug	EUR 339

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171)
VAng-Cr3554-1mgEcoli	Creative Biolabs	1 mg (E. coli)	EUR 3294
Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein.

Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171)
VAng-Cr3554-500gEcoli	Creative Biolabs	500 µg (E. coli)	EUR 2360
Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein.

Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171)
VAng-Cr3554-50gEcoli	Creative Biolabs	50 µg (E. coli)	EUR 1618
Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein.

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

Sri sgRNA CRISPR Lentivector (Rat) (Target 1)
K7508102	ABM	1.0 ug DNA	EUR 154

Sri sgRNA CRISPR Lentivector (Rat) (Target 2)
K7508103	ABM	1.0 ug DNA	EUR 154

Sri sgRNA CRISPR Lentivector (Rat) (Target 3)
K7508104	ABM	1.0 ug DNA	EUR 154

Sri sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3050702	ABM	1.0 ug DNA	EUR 154

Sri sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3050703	ABM	1.0 ug DNA	EUR 154

Sri sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3050704	ABM	1.0 ug DNA	EUR 154

SRI Protein Vector (Rat) (pPB-C-His)
PV308062	ABM	500 ng	EUR 603

SRI Protein Vector (Rat) (pPB-N-His)
PV308063	ABM	500 ng	EUR 603

SRI Protein Vector (Rat) (pPM-C-HA)
PV308064	ABM	500 ng	EUR 603

SRI Protein Vector (Rat) (pPM-C-His)
PV308065	ABM	500 ng	EUR 603

SRI Protein Vector (Mouse) (pPB-C-His)
PV233882	ABM	500 ng	EUR 603

SRI Protein Vector (Mouse) (pPB-N-His)
PV233883	ABM	500 ng	EUR 603

SRI Protein Vector (Mouse) (pPM-C-HA)
PV233884	ABM	500 ng	EUR 603

SRI Protein Vector (Mouse) (pPM-C-His)
PV233885	ABM	500 ng	EUR 603

SRI Protein Vector (Mouse) (pPB-C-His)
PV233886	ABM	500 ng	EUR 603

SRI Protein Vector (Mouse) (pPB-N-His)
PV233887	ABM	500 ng	EUR 603

SRI Protein Vector (Mouse) (pPM-C-HA)
PV233888	ABM	500 ng	EUR 603

SRI Protein Vector (Mouse) (pPM-C-His)
PV233889	ABM	500 ng	EUR 603

Sri 3'UTR Luciferase Stable Cell Line
TU119686	ABM	1.0 ml	Ask for price

Sri 3'UTR GFP Stable Cell Line
TU169686	ABM	1.0 ml	Ask for price

Sri 3'UTR Luciferase Stable Cell Line
TU221173	ABM	1.0 ml	Ask for price

SRI 3'UTR GFP Stable Cell Line
TU074588	ABM	1.0 ml	EUR 1394

Sri 3'UTR GFP Stable Cell Line
TU271173	ABM	1.0 ml	Ask for price

SRI 3'UTR Luciferase Stable Cell Line
TU024588	ABM	1.0 ml	EUR 1394

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Recombinant Schistosoma Japonicum Sorcin Protein (aa 1-171) (Baculovirus)
VAng-Cr8506-1mg	Creative Biolabs	1 mg	EUR 7625
Description: Schistosoma Japonicum (Blood fluke) Sorcin, recombinant protein.

Recombinant Schistosoma Japonicum Sorcin Protein (aa 1-171) (Baculovirus)
VAng-Cr8506-500g	Creative Biolabs	500 µg	EUR 4917
Description: Schistosoma Japonicum (Blood fluke) Sorcin, recombinant protein.

Recombinant Schistosoma Japonicum Sorcin Protein (aa 1-171) (Baculovirus)
VAng-Cr8506-50g	Creative Biolabs	50 µg	EUR 2649
Description: Schistosoma Japonicum (Blood fluke) Sorcin, recombinant protein.

SRI sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2285005	ABM	3 x 1.0 ug	EUR 376

Monoclonal SRI Antibody (monoclonal) (M01), Clone: 1.0E+12
AMM04136G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human SRI (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1.0E+12. This antibody is applicable in WB

SRI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV638533	ABM	1.0 ug DNA	EUR 514

SRI Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV638537	ABM	1.0 ug DNA	EUR 514

SRI Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV638538	ABM	1.0 ug DNA	EUR 514

SRI sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2285006	ABM	1.0 ug DNA	EUR 167

SRI sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2285007	ABM	1.0 ug DNA	EUR 167

SRI sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2285008	ABM	1.0 ug DNA	EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Sri sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7508105	ABM	3 x 1.0 ug	EUR 376

Sri sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3050705	ABM	3 x 1.0 ug	EUR 376

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

SRI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV638534	ABM	1.0 ug DNA	EUR 514

SRI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV638535	ABM	1.0 ug DNA	EUR 572

SRI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV638536	ABM	1.0 ug DNA	EUR 572

Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7508106	ABM	1.0 ug DNA	EUR 167

Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7508107	ABM	1.0 ug DNA	EUR 167

Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7508108	ABM	1.0 ug DNA	EUR 167

Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3050706	ABM	1.0 ug DNA	EUR 167

Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3050707	ABM	1.0 ug DNA	EUR 167

Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3050708	ABM	1.0 ug DNA	EUR 167

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit
ELA-E0121h	Lifescience Market	96 Tests	EUR 824

Human KIT/SCFR ELISA kit
LF-EK50791	Abfrontier	1×96T	EUR 648

Human CCRN4L/ Nocturnin ELISA KIT (Sandwich ELISA kit)
ELI-21230h	Lifescience Market	96 Tests	EUR 824

Human GLMN (Glomulin) ELISA Kit (CUSTOM ELISA KIT)
ELI-27987h	Lifescience Market	96 Tests	EUR 824

Human Pentosidine ELISA Kit
201-12-0005	SunredBio	96 tests	EUR 440
This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Amylin ELISA Kit
201-12-0017	SunredBio	96 tests	EUR 440
This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human visfatin ELISA Kit
201-12-0026	SunredBio	96 tests	EUR 440
This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Secretin ELISA Kit
201-12-0027	SunredBio	96 tests	EUR 440
This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human omentin ELISA Kit
201-12-0156	SunredBio	96 tests	EUR 440
This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human Resistin ELISA KIT
201-12-0339	SunredBio	96 tests	EUR 440
This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Collectin ELISA Kit
201-12-0354	SunredBio	96 tests	EUR 440
This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Agrin ELISA Kit
201-12-0414	SunredBio	96 tests	EUR 440
This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thymosin ELISA Kit
201-12-0416	SunredBio	96 tests	EUR 440
This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human talin ELISA Kit
201-12-0620	SunredBio	96 tests	EUR 440
This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ponticulin ELISA Kit
201-12-0633	SunredBio	96 tests	EUR 440
This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Slit2 ELISA Kit
201-12-0662	SunredBio	96 tests	EUR 440
This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human trypsin ELISA Kit
201-12-0805	SunredBio	96 tests	EUR 440
This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Elastase ELISA Kit
201-12-0812	SunredBio	96 tests	EUR 440
This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.