Human SRI(Sorcin) ELISA Kit

Human SRI(Sorcin) ELISA Kit

To Order Contact us: 

    Human SRI/ Sorcin ELISA Kit

    E2391Hu 1 Kit
    EUR 605

    Human Sorcin, SRI ELISA KIT

    ELI-30055h 96 Tests
    EUR 824

    Human Sorcin (SRI) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Sorcin (SRI)ELISA Kit

    201-12-2543 96 tests
    EUR 440
    • This Sorcin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Sorcin(SRI)ELISA Kit

    QY-E02519 96T
    EUR 361

    Human Sorcin (SRI) ELISA Kit

    SEH133Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

    Human Sorcin (SRI) ELISA Kit

    SEH133Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

    Human Sorcin (SRI) ELISA Kit

    SEH133Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

    Human Sorcin (SRI) ELISA Kit

    SEH133Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sorcin (SRI) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sorcin (SRI) in Tissue homogenates, cell lysates and other biological fluids.

    Human Sorcin (SRI) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Sorcin elisa. Alternative names of the recognized antigen: SCN
    • CP-22
    • V19
    • 22 kDa protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sorcin (SRI) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Mouse Sorcin (SRI) ELISA Kit

    abx555639-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.

    Mouse Sri/ Sorcin ELISA Kit

    E1413Mo 1 Kit
    EUR 632

    Mouse Sorcin, Sri ELISA KIT

    ELI-53405m 96 Tests
    EUR 865

    Sorcin (SRI) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Sorcin (SRI) Antibody

    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Sorcin (SRI) Antibody

    • EUR 370.00
    • EUR 606.00
    • EUR 300.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Sorcin (SRI) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Sorcin (SRI) Antibody

    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Sorcin (SRI) Antibody

    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Sorcin (SRI) Protein

    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    Sorcin (SRI) Antibody

    abx238228-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Recombinant Sorcin (SRI)

    • EUR 458.40
    • EUR 226.00
    • EUR 1444.00
    • EUR 548.00
    • EUR 996.00
    • EUR 370.00
    • EUR 3460.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P30626
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 19.4kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Sorcin expressed in: E.coli

    ELISA kit for Human SRI (Sorcin)

    ELK5034 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sorcin (SRI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sorcin (SRI). Next, A
    • Show more
    Description: A sandwich ELISA kit for detection of Sorcin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Sorcin (SRI)

    KTE60358-48T 48T
    EUR 332
    • The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Sorcin (SRI)

    KTE60358-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Sorcin (SRI)

    KTE60358-96T 96T
    EUR 539
    • The 22-kD sorcin protein was overexpressed in HOB1/VCR-1.0 cells, a multidrug-resistant human B immunoblastic lymphoma cell line. By PCR with primers based on the sequence of hamster sorcin, the authors recovered a partial human sorcin cDNA. Using th
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Human Sorcin (SRI) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Sorcin (SRI) Protein

    • EUR 648.00
    • EUR 272.00
    • EUR 1943.00
    • EUR 759.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    ELISA kit for Mouse Sorcin (SRI)

    KTE70255-48T 48T
    EUR 332
    • Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Sorcin (SRI)

    KTE70255-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Sorcin (SRI)

    KTE70255-96T 96T
    EUR 539
    • Sarcalumenin is a gene which encodes a 160-kD glycoprotein protein involved in calcium signaling.Muscle contraction is triggered by the release of calcium from the sarcoplasmic reticulum, whereas muscle relaxation is achieved by rapid reuptake of cal
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Sorcin (SRI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Sri ELISA Kit| Mouse Sorcin ELISA Kit

    EF016248 96 Tests
    EUR 689

    SRI Sorcin Human Recombinant Protein

    PROTP30626 Regular: 20ug
    EUR 317
    Description: SRI Human Recombinant fused with a 23 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 221 amino acids (1-198 a.a.) and having a molecular mass of 24.1kDa. The SRI is purified by proprietary chromatographic techniques.

    Sorcin (SRI) Polyclonal Antibody (Human)

    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SRI (Gly29~Leu169)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sorcin (SRI)

    Sorcin (SRI) Polyclonal Antibody (Human), APC

    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SRI (Gly29~Leu169)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with APC.

    Sorcin (SRI) Polyclonal Antibody (Human), Biotinylated

    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SRI (Gly29~Leu169)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with Biotin.

    Sorcin (SRI) Polyclonal Antibody (Human), Cy3

    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SRI (Gly29~Leu169)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with Cy3.

    Sorcin (SRI) Polyclonal Antibody (Human), FITC

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SRI (Gly29~Leu169)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with FITC.

    Sorcin (SRI) Polyclonal Antibody (Human), HRP

    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SRI (Gly29~Leu169)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with HRP.

    Sorcin (SRI) Polyclonal Antibody (Human), PE

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SRI (Gly29~Leu169)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with PE.

    Polyclonal SRI / Sorcin Antibody (aa50-100)

    APR02437G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SRI / Sorcin (aa50-100). This antibody is tested and proven to work in the following applications:

    Sorcin (SRI) Polyclonal Antibody (Human), APC-Cy7

    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SRI (Gly29~Leu169)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sorcin (SRI). This antibody is labeled with APC-Cy7.

    Recombinant Human SRI/ Sorcin Protein, GST, E.coli-100ug

    QP6727-ec-100ug 100ug
    EUR 408

    Recombinant Human SRI/ Sorcin Protein, GST, E.coli-10ug

    QP6727-ec-10ug 10ug
    EUR 200

    Recombinant Human SRI/ Sorcin Protein, GST, E.coli-1mg

    QP6727-ec-1mg 1mg
    EUR 1632

    Recombinant Human SRI/ Sorcin Protein, GST, E.coli-200ug

    QP6727-ec-200ug 200ug
    EUR 634

    Recombinant Human SRI/ Sorcin Protein, GST, E.coli-500ug

    QP6727-ec-500ug 500ug
    EUR 1060

    Recombinant Human SRI/ Sorcin Protein, GST, E.coli-50ug

    QP6727-ec-50ug 50ug
    EUR 263


    EF003232 96 Tests
    EUR 689

    ELISA kit for Human Sorcin

    EK3730 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Sorcin in samples from serum, plasma, tissue homogenates and other biological fluids.

    SRI ELISA Kit (Human) (OKCD01022)

    OKCD01022 96 Wells
    EUR 831
    Description: Description of target: Calcium-binding protein that modulates excitation-contraction coupling in the heart. Contributes to calcium homeostasis in the heart sarcoplasmic reticulum. Modulates the activity of RYR2 calcium channels.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.16"Molecular basis for the impaired function of the natural F112L sorcin mutant: X-ray crystal structure, calcium affinity, and interaction with annexin VII and the ryanodine receptor."_x005F_x005F_x000D_Franceschini S., Ilari A., Verzili D., Zamparelli C., Antaramian A., Rueda A., Valdivia H.H., Chiancone E., Colotti G._x005F_x005F_x000D_FASEB J. 22:295-306(2008) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.5 ANGSTROMS) OF MUTANT LEU-112, SUBUNIT, FUNCTION, CALCIUM-BINDING, INTERACTION WITH RYR2 AND ANXA7. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.119 ng/mL

    SRI ELISA Kit (Human) (OKEH03543)

    OKEH03543 96 Wells
    EUR 779
    Description: Description of target: Calcium-binding protein that modulates excitation-contraction coupling in the heart. Contributes to calcium homeostasis in the heart sarcoplasmic reticulum. Modulates the activity of RYR2 calcium channels.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.176 ng/mL

    ELISA kit for Mouse Sorcin

    EK3729 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Sorcin in samples from serum, plasma, tissue homogenates and other biological fluids.

    Recombinant Human Sorcin

    7-06526 5µg Ask for price

    Recombinant Human Sorcin

    7-06527 20µg Ask for price

    Recombinant Human Sorcin

    7-06528 1mg Ask for price

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    SRI antibody

    70R-20520 50 ul
    EUR 435
    Description: Rabbit polyclonal SRI antibody

    SRI siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SRI siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SRI Antibody

    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against SRI. Recognizes SRI from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

    SRI Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against SRI. Recognizes SRI from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    Human SRI shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    SRI Recombinant Protein (Human)

    RP030076 100 ug Ask for price

    SRI cloning plasmid

    CSB-CL022665HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 597
    • Sequence: atggcgtacccggggcatcctggcgccggcggcgggtactacccaggcgggtatggaggggctcccggagggcctgcgtttcccggacaaactcaggatccgctgtatggttactttgctgctgtagctggacaggatgggcagatagatgctgatgaattgcagagatgtctgac
    • Show more
    Description: A cloning plasmid for the SRI gene.

    SRI-011381 (hydrochloride)

    HY-100347A 50mg
    EUR 1097

    SRI 31215 (TFA)

    HY-114363A 100mg
    EUR 1887

    anti- SRI antibody

    FNab08228 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • Immunogen: sorcin
    • Uniprot ID: P30626
    • Gene ID: 6717
    • Research Area: Neuroscience, Cardiovascular, Signal Transduction
    Description: Antibody raised against SRI

    Anti-SRI Antibody

    A00222 100ug/vial
    EUR 334

    SRI Rabbit pAb

    A6751-100ul 100 ul
    EUR 308

    SRI Rabbit pAb

    A6751-200ul 200 ul
    EUR 459

    SRI Rabbit pAb

    A6751-20ul 20 ul
    EUR 183

    SRI Rabbit pAb

    A6751-50ul 50 ul
    EUR 223

    SRI Polyclonal Antibody

    42331-100ul 100ul
    EUR 333

    Anti-SRI antibody

    PAab08228 100 ug
    EUR 386

    Anti-SRI antibody

    STJ28834 100 µl
    EUR 277
    Description: This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene.

    Anti-SRI antibody

    STJ11100797 100 µl
    EUR 413
    Description: This gene encodes a calcium-binding protein with multiple E-F hand domains that relocates from the cytoplasm to the sarcoplasmic reticulum in response to elevated calcium levels. In addition to regulating intracellular calcium homeostasis it also modulates excitation-contraction coupling in the heart. Alternative splicing results in multiple transcript variants encoding distinct proteins. Multiple pseudogenes exist for this gene.

    SRI ORF Vector (Human) (pORF)

    ORF010026 1.0 ug DNA
    EUR 95

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    SRI Polyclonal Conjugated Antibody

    C42331 100ul
    EUR 397

    Mouse SRI shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    SRI protein (His tag)

    80R-1699 100 ug
    EUR 305
    Description: Purified recombinant Human SRI protein

    SRI Recombinant Protein (Rat)

    RP231044 100 ug Ask for price

    SRI Recombinant Protein (Mouse)

    RP175409 100 ug Ask for price

    SRI Recombinant Protein (Mouse)

    RP175412 100 ug Ask for price

    Anti-SR1/SRI Antibody

    RP1110 100ug/vial
    EUR 294

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    SRI sgRNA CRISPR Lentivector set (Human)

    K2285001 3 x 1.0 ug
    EUR 339

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    [KO Validated] SRI Rabbit pAb

    A19921-100ul 100 ul
    EUR 410

    [KO Validated] SRI Rabbit pAb

    A19921-200ul 200 ul
    EUR 571

    [KO Validated] SRI Rabbit pAb

    A19921-20ul 20 ul
    EUR 221

    [KO Validated] SRI Rabbit pAb

    A19921-50ul 50 ul
    EUR 287

    Sri ORF Vector (Mouse) (pORF)

    ORF058471 1.0 ug DNA
    EUR 506

    Sri ORF Vector (Mouse) (pORF)

    ORF058472 1.0 ug DNA
    EUR 506

    Sri ORF Vector (Rat) (pORF)

    ORF077016 1.0 ug DNA
    EUR 506

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    SRI sgRNA CRISPR Lentivector (Human) (Target 1)

    K2285002 1.0 ug DNA
    EUR 154

    SRI sgRNA CRISPR Lentivector (Human) (Target 2)

    K2285003 1.0 ug DNA
    EUR 154

    SRI sgRNA CRISPR Lentivector (Human) (Target 3)

    K2285004 1.0 ug DNA
    EUR 154

    SRI Protein Vector (Human) (pPB-C-His)

    PV040101 500 ng
    EUR 329

    SRI Protein Vector (Human) (pPB-N-His)

    PV040102 500 ng
    EUR 329

    SRI Protein Vector (Human) (pPM-C-HA)

    PV040103 500 ng
    EUR 329

    SRI Protein Vector (Human) (pPM-C-His)

    PV040104 500 ng
    EUR 329

    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE622A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE624A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    Sri sgRNA CRISPR Lentivector set (Mouse)

    K3050701 3 x 1.0 ug
    EUR 339

    Sri sgRNA CRISPR Lentivector set (Rat)

    K7508101 3 x 1.0 ug
    EUR 339

    vWF Acty. Kit

    ABP-ACT-KIT 12 x 8 microwells
    EUR 428

    vWF Ant. Kit

    ABP-TOT-KIT 12 x 8 microwells
    EUR 394

    Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171)

    VAng-Cr3554-1mgEcoli 1 mg (E. coli)
    EUR 3294
    Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein.

    Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171)

    VAng-Cr3554-500gEcoli 500 µg (E. coli)
    EUR 2360
    Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein.

    Recombinant Schistosoma Japonicum sorcin Protein (aa 1-171)

    VAng-Cr3554-50gEcoli 50 µg (E. coli)
    EUR 1618
    Description: Schistosoma Japonicum (Blood fluke) sorcin, recombinant protein.

    hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

    CAS620A-KIT 1 kit
    EUR 2152
    • Category: Cas9
    Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PrecisionX Multiplex gRNA Cloning Kit

    CAS9-GRNA-KIT 10 rxn
    EUR 445
    • Category: Cas9

    Sri sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3050702 1.0 ug DNA
    EUR 154

    Sri sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3050703 1.0 ug DNA
    EUR 154

    Sri sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3050704 1.0 ug DNA
    EUR 154

    Sri sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7508102 1.0 ug DNA
    EUR 154

    Sri sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7508103 1.0 ug DNA
    EUR 154

    Sri sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7508104 1.0 ug DNA
    EUR 154

    SRI Protein Vector (Rat) (pPB-C-His)

    PV308062 500 ng
    EUR 603

    SRI Protein Vector (Rat) (pPB-N-His)

    PV308063 500 ng
    EUR 603

    SRI Protein Vector (Rat) (pPM-C-HA)

    PV308064 500 ng
    EUR 603

    SRI Protein Vector (Rat) (pPM-C-His)

    PV308065 500 ng
    EUR 603

    SRI Protein Vector (Mouse) (pPB-C-His)

    PV233882 500 ng
    EUR 603

    SRI Protein Vector (Mouse) (pPB-N-His)

    PV233883 500 ng
    EUR 603

    SRI Protein Vector (Mouse) (pPM-C-HA)

    PV233884 500 ng
    EUR 603

    SRI Protein Vector (Mouse) (pPM-C-His)

    PV233885 500 ng
    EUR 603

    SRI Protein Vector (Mouse) (pPB-C-His)

    PV233886 500 ng
    EUR 603

    SRI Protein Vector (Mouse) (pPB-N-His)

    PV233887 500 ng
    EUR 603

    SRI Protein Vector (Mouse) (pPM-C-HA)

    PV233888 500 ng
    EUR 603

    SRI Protein Vector (Mouse) (pPM-C-His)

    PV233889 500 ng
    EUR 603

    Sri 3'UTR GFP Stable Cell Line

    TU169686 1.0 ml Ask for price

    Sri 3'UTR Luciferase Stable Cell Line

    TU119686 1.0 ml Ask for price

    SRI 3'UTR GFP Stable Cell Line

    TU074588 1.0 ml
    EUR 1394

    SRI 3'UTR Luciferase Stable Cell Line

    TU024588 1.0 ml
    EUR 1394

    Sri 3'UTR Luciferase Stable Cell Line

    TU221173 1.0 ml Ask for price

    Sri 3'UTR GFP Stable Cell Line

    TU271173 1.0 ml Ask for price

    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes

    mRNAExpress mRNA Synthesis kit (5 reactions)

    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products

    Recombinant Schistosoma Japonicum Sorcin Protein (aa 1-171) (Baculovirus)

    VAng-Cr8506-1mg 1 mg
    EUR 7625
    Description: Schistosoma Japonicum (Blood fluke) Sorcin, recombinant protein.

    Recombinant Schistosoma Japonicum Sorcin Protein (aa 1-171) (Baculovirus)

    VAng-Cr8506-500g 500 µg
    EUR 4917
    Description: Schistosoma Japonicum (Blood fluke) Sorcin, recombinant protein.

    Recombinant Schistosoma Japonicum Sorcin Protein (aa 1-171) (Baculovirus)

    VAng-Cr8506-50g 50 µg
    EUR 2649
    Description: Schistosoma Japonicum (Blood fluke) Sorcin, recombinant protein.

    SRI sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

    K2285005 3 x 1.0 ug
    EUR 376

    Monoclonal SRI Antibody (monoclonal) (M01), Clone: 1.0E+12

    AMM04136G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human SRI (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1.0E+12. This antibody is applicable in WB

    SRI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

    LV638533 1.0 ug DNA
    EUR 514

    SRI Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

    LV638537 1.0 ug DNA
    EUR 514

    SRI Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

    LV638538 1.0 ug DNA
    EUR 514

    SRI sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

    K2285006 1.0 ug DNA
    EUR 167

    SRI sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

    K2285007 1.0 ug DNA
    EUR 167

    SRI sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

    K2285008 1.0 ug DNA
    EUR 167

    CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

    CASCL9-100A-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Sri sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

    K3050705 3 x 1.0 ug
    EUR 376

    Sri sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

    K7508105 3 x 1.0 ug
    EUR 376


    AP-STR-KIT-P 1/pk
    EUR 721
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

    K3050706 1.0 ug DNA
    EUR 167

    Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

    K3050707 1.0 ug DNA
    EUR 167

    Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

    K3050708 1.0 ug DNA
    EUR 167

    SRI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

    LV638534 1.0 ug DNA
    EUR 514

    SRI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

    LV638535 1.0 ug DNA
    EUR 572

    SRI Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

    LV638536 1.0 ug DNA
    EUR 572

    Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

    K7508106 1.0 ug DNA
    EUR 167

    Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

    K7508107 1.0 ug DNA
    EUR 167

    Sri sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

    K7508108 1.0 ug DNA
    EUR 167


    AP-STR-KIT-1 1/pk
    EUR 355
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller


    AP-STR-KIT-2 1/pk
    EUR 367
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Human Kit ELISA Kit

    ELA-E0121h 96 Tests
    EUR 824

    Human KIT/SCFR ELISA kit

    LF-EK50791 1×96T
    EUR 648

    KIT ELISA Kit (Human) (OKAN04574)

    OKAN04574 96 Wells
    EUR 792
    Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

    KIT ELISA Kit (Human) (OKCD06003)

    OKCD06003 96 Wells
    EUR 648
    Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

    Human Biopterin ELISA Kit

    CELI-66011h 96 Tests
    EUR 824

    Human lipopolysaccharides ELISA Kit

    CELI-66031h 96 Tests
    EUR 824

    Human Microlbumin ELISA Kit

    abx517025-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Trypsin ELISA kit

    E01T0139-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Trypsin ELISA kit

    E01T0139-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Trypsin ELISA kit

    E01T0139-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Trypsin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptophane ELISA kit

    E01T0140-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptophane ELISA kit

    E01T0140-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Tryptophane ELISA kit

    E01T0140-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Tryptophane in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thyroglobulin ELISA kit

    E01T0141-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thyroglobulin ELISA kit

    E01T0141-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Thyroglobulin ELISA kit

    E01T0141-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Thyroglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.