Human TMPO(Thymopoietin) ELISA Kit

Human TMPO(Thymopoietin) ELISA Kit

To Order Contact us: 

    Human Thymopoietin (TMPO) ELISA Kit

    SEC824Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

    Human Thymopoietin (TMPO) ELISA Kit

    SEC824Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

    Human Thymopoietin (TMPO) ELISA Kit

    SEC824Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

    Human Thymopoietin (TMPO) ELISA Kit

    SEC824Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thymopoietin (TMPO) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thymopoietin (TMPO) in serum, plasma, tissue homogenates and other biological fluids.

    Human Thymopoietin (TMPO) ELISA Kit

    4-SEC824Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Thymopoietin elisa. Alternative names of the recognized antigen: TP
    • LAP2
    • CMD1T
    • LEMD4
    • TP5
    • Splenin
    • Lamina-Associated Polypeptide 2, Isoforms Beta/Gamma
    • LEM Domain Containing 4
    • Thymopoietin-related peptide isoforms beta/gamma
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thymopoietin (TMPO) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Mouse Thymopoietin (TMPO) ELISA Kit

    abx516010-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rat Thymopoietin (TMPO) ELISA Kit

    abx516012-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Mouse Thymopoietin(TMPO)ELISA kit

    GA-E0838MS-48T 48T
    EUR 336

    Mouse Thymopoietin(TMPO)ELISA kit

    GA-E0838MS-96T 96T
    EUR 534

    Rat Thymopoietin(TMPO)ELISA kit

    QY-E10460 96T
    EUR 361

    Mouse Thymopoietin(TMPO)ELISA kit

    QY-E21460 96T
    EUR 361

    Thymopoietin (TMPO) Antibody

    abx028266-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Thymopoietin (TMPO) Antibody

    abx028266-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Thymopoietin (TMPO) Antibody

    20-abx116091
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Thymopoietin (TMPO) Antibody

    20-abx131651
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Thymopoietin (TMPO) Antibody

    20-abx142268
    • EUR 370.00
    • EUR 606.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Thymopoietin (TMPO) Antibody

    20-abx174779
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Thymopoietin (TMPO) Antibody

    abx030767-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Thymopoietin (TMPO) Antibody

    abx030767-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Thymopoietin (TMPO) Antibody

    20-abx001974
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Recombinant Thymopoietin (TMPO)

    4-RPC824Hu01
    • EUR 445.86
    • EUR 222.00
    • EUR 1396.96
    • EUR 532.32
    • EUR 964.64
    • EUR 361.00
    • EUR 3342.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P42167
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 30.5kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Thymopoietin expressed in: E.coli

    ELISA kit for Human TMPO (Thymopoietin)

    ELK4922 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thymopoietin (TMPO). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thymopoietin (
    • Show more
    Description: A sandwich ELISA kit for detection of Thymopoietin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Thymopoietin (TMPO) CLIA Kit

    20-abx493916
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Thymopoietin (TMPO) Protein

    20-abx650199
    • EUR 620.00
    • EUR 272.00
    • EUR 1887.00
    • EUR 746.00
    • EUR 453.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse)

    4-PAC824Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TMPO (Met1~Leu243)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO)

    Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC

    4-PAC824Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TMPO (Met1~Leu243)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC.

    Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Biotinylated

    4-PAC824Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TMPO (Met1~Leu243)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Biotin.

    Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), Cy3

    4-PAC824Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TMPO (Met1~Leu243)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with Cy3.

    Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), FITC

    4-PAC824Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TMPO (Met1~Leu243)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with FITC.

    Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), HRP

    4-PAC824Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TMPO (Met1~Leu243)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with HRP.

    Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), PE

    4-PAC824Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TMPO (Met1~Leu243)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with PE.

    Thymopoietin (TMPO) Polyclonal Antibody (Human, Mouse), APC-Cy7

    4-PAC824Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TMPO (Met1~Leu243)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse Thymopoietin (TMPO). This antibody is labeled with APC-Cy7.

    Polyclonal TMPO / TP / Thymopoietin Antibody (N-Terminus)

    APR03096G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TMPO / TP / Thymopoietin (N-Terminus). This antibody is tested and proven to work in the following applications:

    Human TMPO ELISA KIT

    ELI-04132h 96 Tests
    EUR 824

    TMPO ELISA Kit (Human) (OKCD02937)

    OKCD02937 96 Wells
    EUR 831
    Description: Description of target: May help direct the assembly of the nuclear lamina and thereby help maintain the structural organization of the nuclear envelope. Possible receptor for attachment of lamin filaments to the inner nuclear membrane. May be involved in the control of initiation of DNA replication through its interaction with NAKAP95. Thymopoietin (TP) and Thymopentin (TP5) may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12.9 pg/mL

    TMPO ELISA Kit (Human) (OKEI00289)

    OKEI00289 96 Wells
    EUR 767
    Description: Description of target: May be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly. Plays an important role, together with LMNA, in the nuclear anchorage of RB1. TP and TP5 may play a role in T-cell development and function. TP5 is an immunomodulating pentapeptide. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.938 ng/mL

    TMPO/TMPO Antibody

    1-CSB-PA259190
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
    Description: A polyclonal antibody against TMPO/TMPO. Recognizes TMPO/TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1:500-10000, ELISA:1:10000

    TMPO / TMPO Antibody

    20-abx329779
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Mouse Tmpo ELISA KIT

    ELI-04131m 96 Tests
    EUR 865

    Mouse Tmpo ELISA KIT

    ELI-04134m 96 Tests
    EUR 865

    Thymopoietin Antibody

    25390-100ul 100ul
    EUR 390

    Thymopoietin antibody

    70R-6297 50 ug
    EUR 467
    Description: Rabbit polyclonal Thymopoietin antibody raised against the N terminal of TMPO

    Thymopoietin antibody

    70R-6298 50 ug
    EUR 467
    Description: Rabbit polyclonal Thymopoietin antibody raised against the middle region of TMPO

    Thymopoietin antibody

    70R-6387 50 ug
    EUR 467
    Description: Rabbit polyclonal Thymopoietin antibody raised against the N terminal of TMPO

    TMPO ELISA Kit (Rat) (OKEH03323)

    OKEH03323 96 Wells
    EUR 662
    Description: Description of target: Binds directly to lamin B1 and chromosomes in a mitotic phosphorylation-regulated manner. May play an important role in nuclear envelope reassembly at the end of mitosis and/or anchoring of the nuclear lamina and interphase chromosomes to the nuclear envelope.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.4 ng/mL

    Thymopoietin Blocking Peptide

    33R-2506 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6298

    Thymopoietin Blocking Peptide

    33R-6275 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6297

    Thymopoietin Blocking Peptide

    33R-7041 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TMPO antibody, catalog no. 70R-6387

    Polyclonal Thymopoietin Antibody

    APR06736G 0.1 mg
    EUR 659
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Thymopoietin . This antibody is tested and proven to work in the following applications:

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    TMPO antibody

    70R-20884 50 ul
    EUR 435
    Description: Rabbit polyclonal TMPO antibody

    TMPO Antibody

    32699-100ul 100ul
    EUR 252

    TMPO Antibody

    DF6994 200ul
    EUR 304
    Description: TMPO Antibody detects endogenous levels of total TMPO.

    TMPO Antibody

    1-CSB-PA023913GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against TMPO. Recognizes TMPO from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

    TMPO siRNA

    20-abx900018
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TMPO siRNA

    20-abx900039
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TMPO siRNA

    20-abx937501
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TMPO siRNA

    20-abx937502
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TMPO siRNA

    20-abx937503
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TMPO Antibody

    ABD6994 100 ug
    EUR 438

    anti-TMPO

    YF-PA27383 50 ug
    EUR 363
    Description: Mouse polyclonal to TMPO

    Human TMPO shRNA Plasmid

    20-abx954879
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human TMPO shRNA Plasmid

    20-abx954880
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    TMPO Recombinant Protein (Human)

    RP032329 100 ug Ask for price

    TMPO Polyclonal Antibody

    46756-100ul 100ul
    EUR 252

    TMPO Polyclonal Antibody

    46756-50ul 50ul
    EUR 187

    TMPO Blocking Peptide

    DF6994-BP 1mg
    EUR 195

    TMPO Conjugated Antibody

    C32699 100ul
    EUR 397

    TMPO cloning plasmid

    CSB-CL023913HU-10ug 10ug
    EUR 492
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1365
    • Sequence: atgccggagttcctggaagacccctcggtcctgacaaaagacaagttgaagagtgagttggtcgccaacaatgtgacgctgccggccggggagcagcgcaaagacgtgtacgtccagctctacctgcagcacctcacggctcgcaaccggccgccgctccccgccggcaccaaca
    • Show more
    Description: A cloning plasmid for the TMPO gene.

    TMPO Polyclonal Antibody

    ABP57555-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
    • Applications tips:
    Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

    TMPO Polyclonal Antibody

    ABP57555-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
    • Applications tips:
    Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

    TMPO Polyclonal Antibody

    ABP57555-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthetic peptide from human protein at AA range: 1-50
    • Applications tips:
    Description: A polyclonal antibody for detection of TMPO from Human, Mouse, Rat. This TMPO antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide from human protein at AA range: 1-50

    TMPO Polyclonal Antibody

    ES8548-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    TMPO Polyclonal Antibody

    ES8548-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against TMPO from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    Anti-TMPO antibody

    STJ25881 100 µl
    EUR 413
    Description: The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.

    Anti-TMPO antibody

    STJ98661 200 µl
    EUR 197
    Description: TMPO is a protein encoded by the TMPO gene which is approximately 75,4 kDa. TMPO is localised to the nucleus and is involved in the mitotic cell cycle, nuclear envelope reassembly, transport of the SLBP independent mature mRNA and apoptosis. It may be involved in the structural organization of the nucleus and in the post-mitotic nuclear assembly and plays an important role, together with LMNA, in the nuclear anchorage of RB1. It may also be involved in the control of initiation of DNA replication through its interaction with NAKAP95. TMPO is expressed in many tissues and is most abundant in adult thymus and fetal liver. Mutations in the TMPO gene result in dilated cardiomyopathy and dysentery. STJ98661 was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen. This antibody detects endogenous TMPO protein.

    TMPO ORF Vector (Human) (pORF)

    ORF010777 1.0 ug DNA
    EUR 95

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Anti-TMPO/Lap2 Antibody

    A03278 100ul
    EUR 397
    Description: Rabbit Polyclonal Antibody for TMPO Antibody (TMPO) detection.tested for IHC, WB in Human, Mouse, Rat.

    Mouse TMPO shRNA Plasmid

    20-abx973144
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse TMPO shRNA Plasmid

    20-abx973145
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat TMPO shRNA Plasmid

    20-abx984957
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    TMPO Recombinant Protein (Rat)

    RP233936 100 ug Ask for price

    TMPO Recombinant Protein (Mouse)

    RP180017 100 ug Ask for price

    TMPO Recombinant Protein (Mouse)

    RP180020 100 ug Ask for price

    TMPO Recombinant Protein (Mouse)

    RP180023 100 ug Ask for price

    TMPO Recombinant Protein (Mouse)

    RP180026 100 ug Ask for price

    TMPO Recombinant Protein (Mouse)

    RP180029 100 ug Ask for price

    TMPO Recombinant Protein (Mouse)

    RP180032 100 ug Ask for price

    TMPO sgRNA CRISPR Lentivector set (Human)

    K2409901 3 x 1.0 ug
    EUR 339

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9

    Human TMPO/ Lamina-associated polypeptide 2, isoforms beta/gamma ELISA Kit

    E2522Hu 1 Kit
    EUR 571

    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS750A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS770A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

    CAS790A-KIT 10 rxn
    EUR 1132
    • Category: Cas9

    Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

    CAS9LIG-KIT 1 Kit
    EUR 153
    • Category: Cas9

    [KO Validated] TMPO Rabbit pAb

    A2534-100ul 100 ul
    EUR 410

    [KO Validated] TMPO Rabbit pAb

    A2534-200ul 200 ul
    EUR 571

    [KO Validated] TMPO Rabbit pAb

    A2534-20ul 20 ul
    EUR 221

    [KO Validated] TMPO Rabbit pAb

    A2534-50ul 50 ul
    EUR 287

    Tmpo ORF Vector (Rat) (pORF)

    ORF077980 1.0 ug DNA
    EUR 506

    Tmpo ORF Vector (Mouse) (pORF)

    ORF060007 1.0 ug DNA
    EUR 506

    Tmpo ORF Vector (Mouse) (pORF)

    ORF060008 1.0 ug DNA
    EUR 506

    Tmpo ORF Vector (Mouse) (pORF)

    ORF060009 1.0 ug DNA
    EUR 506

    Tmpo ORF Vector (Mouse) (pORF)

    ORF060010 1.0 ug DNA
    EUR 506

    Tmpo ORF Vector (Mouse) (pORF)

    ORF060011 1.0 ug DNA
    EUR 506

    Tmpo ORF Vector (Mouse) (pORF)

    ORF060012 1.0 ug DNA
    EUR 506

    pECMV-Tmpo-m-FLAG Plasmid

    PVT14942 2 ug
    EUR 325

    Rat Tmpo/ Lamina-associated polypeptide 2, isoform beta ELISA Kit

    E0983Ra 1 Kit
    EUR 571

    TMPO sgRNA CRISPR Lentivector (Human) (Target 1)

    K2409902 1.0 ug DNA
    EUR 154

    TMPO sgRNA CRISPR Lentivector (Human) (Target 2)

    K2409903 1.0 ug DNA
    EUR 154

    TMPO sgRNA CRISPR Lentivector (Human) (Target 3)

    K2409904 1.0 ug DNA
    EUR 154

    TMPO Protein Vector (Human) (pPB-C-His)

    PV043105 500 ng
    EUR 329

    TMPO Protein Vector (Human) (pPB-N-His)

    PV043106 500 ng
    EUR 329

    TMPO Protein Vector (Human) (pPM-C-HA)

    PV043107 500 ng
    EUR 329

    TMPO Protein Vector (Human) (pPM-C-His)

    PV043108 500 ng
    EUR 329

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE620A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE622A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

    GE624A-KIT 1 kit
    EUR 2132
    • Category: Gene Editing

    ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO)

    KTE70153-48T 48T
    EUR 332
    • Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO)

    KTE70153-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO)

    KTE70153-96T 96T
    EUR 539
    • Thymopoietin is a protein involved in the induction of CD90 in the thymus. The thymopoetin (TMPO) gene encodes three alternatively spliced mRNAs encoding proteins of 75 kDa (alpha), 51 kDa (beta) and 39 kDa (gamma) which are ubiquitously expressed in
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Lamina-associated polypeptide 2, isoform alpha (TMPO) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Tmpo sgRNA CRISPR Lentivector set (Rat)

    K6772801 3 x 1.0 ug
    EUR 339

    Tmpo sgRNA CRISPR Lentivector set (Mouse)

    K4483401 3 x 1.0 ug
    EUR 339

    vWF Acty. Kit

    ABP-ACT-KIT 12 x 8 microwells
    EUR 428

    vWF Ant. Kit

    ABP-TOT-KIT 12 x 8 microwells
    EUR 394

    hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

    CAS620A-KIT 1 kit
    EUR 2152
    • Category: Cas9
    Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools

    PrecisionX Multiplex gRNA Cloning Kit

    CAS9-GRNA-KIT 10 rxn
    EUR 445
    • Category: Cas9

    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes

    mRNAExpress mRNA Synthesis kit (5 reactions)

    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products

    Tmpo sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6772802 1.0 ug DNA
    EUR 154

    Tmpo sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6772803 1.0 ug DNA
    EUR 154

    Tmpo sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6772804 1.0 ug DNA
    EUR 154

    Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4483402 1.0 ug DNA
    EUR 154

    Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4483403 1.0 ug DNA
    EUR 154

    Tmpo sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4483404 1.0 ug DNA
    EUR 154

    TMPO Protein Vector (Rat) (pPB-C-His)

    PV311918 500 ng
    EUR 603

    TMPO Protein Vector (Rat) (pPB-N-His)

    PV311919 500 ng
    EUR 603

    TMPO Protein Vector (Rat) (pPM-C-HA)

    PV311920 500 ng
    EUR 603

    TMPO Protein Vector (Rat) (pPM-C-His)

    PV311921 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPB-C-His)

    PV240026 500 ng
    EUR 1065

    TMPO Protein Vector (Mouse) (pPB-N-His)

    PV240027 500 ng
    EUR 1065

    TMPO Protein Vector (Mouse) (pPM-C-HA)

    PV240028 500 ng
    EUR 1065

    TMPO Protein Vector (Mouse) (pPM-C-His)

    PV240029 500 ng
    EUR 1065

    TMPO Protein Vector (Mouse) (pPB-C-His)

    PV240030 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPB-N-His)

    PV240031 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPM-C-HA)

    PV240032 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPM-C-His)

    PV240033 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPB-C-His)

    PV240034 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPB-N-His)

    PV240035 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPM-C-HA)

    PV240036 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPM-C-His)

    PV240037 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPB-C-His)

    PV240038 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPB-N-His)

    PV240039 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPM-C-HA)

    PV240040 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPM-C-His)

    PV240041 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPB-C-His)

    PV240042 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPB-N-His)

    PV240043 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPM-C-HA)

    PV240044 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPM-C-His)

    PV240045 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPB-C-His)

    PV240046 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPB-N-His)

    PV240047 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPM-C-HA)

    PV240048 500 ng
    EUR 603

    TMPO Protein Vector (Mouse) (pPM-C-His)

    PV240049 500 ng
    EUR 603

    Tmpo 3'UTR Luciferase Stable Cell Line

    TU120829 1.0 ml Ask for price

    Tmpo 3'UTR GFP Stable Cell Line

    TU170829 1.0 ml Ask for price

    Tmpo 3'UTR Luciferase Stable Cell Line

    TU222191 1.0 ml Ask for price

    TMPO 3'UTR GFP Stable Cell Line

    TU075957 1.0 ml
    EUR 1394

    Tmpo 3'UTR GFP Stable Cell Line

    TU272191 1.0 ml Ask for price

    TMPO 3'UTR Luciferase Stable Cell Line

    TU025957 1.0 ml
    EUR 1394

    Rat Lamina- associated polypeptide 2, isoform beta, Tmpo ELISA K

    ELI-04133r 96 Tests
    EUR 886

    TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

    K2409905 3 x 1.0 ug
    EUR 376

    TMPO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

    LV671011 1.0 ug DNA
    EUR 682

    TMPO Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

    LV671015 1.0 ug DNA
    EUR 682

    TMPO Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

    LV671016 1.0 ug DNA
    EUR 682

    CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

    CASCL9-100A-KIT 1 Kit
    EUR 1132
    • Category: Cas9

    TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

    K2409906 1.0 ug DNA
    EUR 167

    TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

    K2409907 1.0 ug DNA
    EUR 167

    TMPO sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

    K2409908 1.0 ug DNA
    EUR 167

    Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

    K6772805 3 x 1.0 ug
    EUR 376

    Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

    K4483405 3 x 1.0 ug
    EUR 376

    AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

    AP-STR-KIT-P 1/pk
    EUR 721
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

    K6772806 1.0 ug DNA
    EUR 167

    Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

    K6772807 1.0 ug DNA
    EUR 167

    Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

    K6772808 1.0 ug DNA
    EUR 167

    TMPO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

    LV671012 1.0 ug DNA
    EUR 682

    TMPO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

    LV671013 1.0 ug DNA
    EUR 740

    TMPO Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

    LV671014 1.0 ug DNA
    EUR 740

    Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

    K4483406 1.0 ug DNA
    EUR 167

    Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

    K4483407 1.0 ug DNA
    EUR 167

    Tmpo sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

    K4483408 1.0 ug DNA
    EUR 167

    AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

    AP-STR-KIT-1 1/pk
    EUR 355
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

    AP-STR-KIT-2 1/pk
    EUR 367
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

    Human Kit ELISA Kit

    ELA-E0121h 96 Tests
    EUR 824

    Human KIT/SCFR ELISA kit

    LF-EK50791 1×96T
    EUR 648

    KIT ELISA Kit (Human) (OKAN04574)

    OKAN04574 96 Wells
    EUR 792
    Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

    KIT ELISA Kit (Human) (OKCD06003)

    OKCD06003 96 Wells
    EUR 648
    Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

    Human Pentosidine ELISA Kit

    201-12-0005 96 tests
    EUR 440
    • This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Amylin ELISA Kit

    201-12-0017 96 tests
    EUR 440
    • This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human visfatin ELISA Kit

    201-12-0026 96 tests
    EUR 440
    • This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Secretin ELISA Kit

    201-12-0027 96 tests
    EUR 440
    • This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human omentin ELISA Kit

    201-12-0156 96 tests
    EUR 440
    • This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    human Resistin ELISA KIT

    201-12-0339 96 tests
    EUR 440
    • This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Collectin ELISA Kit

    201-12-0354 96 tests
    EUR 440
    • This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Agrin ELISA Kit

    201-12-0414 96 tests
    EUR 440
    • This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Thymosin ELISA Kit

    201-12-0416 96 tests
    EUR 440
    • This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human talin ELISA Kit

    201-12-0620 96 tests
    EUR 440
    • This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human ponticulin ELISA Kit

    201-12-0633 96 tests
    EUR 440
    • This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Slit2 ELISA Kit

    201-12-0662 96 tests
    EUR 440
    • This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human trypsin ELISA Kit

    201-12-0805 96 tests
    EUR 440
    • This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Elastase ELISA Kit

    201-12-0812 96 tests
    EUR 440
    • This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human ?-glucosidase ELISA Kit

    201-12-0854 96 tests
    EUR 440
    • This ?-glucosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human ?-lactamase ELISA Kit

    201-12-0856 96 tests
    EUR 440
    • This ?-lactamase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Methylase ELISA Kit

    201-12-0927 96 tests
    EUR 440
    • This Methylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Pancreastatin ELISA Kit

    201-12-0984 96 tests
    EUR 440
    • This Pancreastatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Cortisol ELISA Kit

    201-12-1004 96 tests
    EUR 440
    • This Cortisol ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Renin ELISA Kit

    201-12-1017 96 tests
    EUR 440
    • This Renin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human podocin ELISA Kit

    201-12-1083 96 tests
    EUR 440
    • This podocin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Nephrin ELISA Kit

    201-12-1092 96 tests
    EUR 440
    • This Nephrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human gelson ELISA Kit

    201-12-1204 96 tests
    EUR 440
    • This gelson ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Salusin ? ELISA Kit

    201-12-1269 96 tests
    EUR 440
    • This Salusin alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Salusin-? ELISA Kit

    201-12-1273 96 tests
    EUR 440
    • This Salusin-? ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human chemerin ELISA Kit

    201-12-1436 96 tests
    EUR 440
    • This chemerin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human dystrophin ELISA Kit

    201-12-1446 96 tests
    EUR 440
    • This dystrophin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human preptin ELISA Kit

    201-12-1449 96 tests
    EUR 440
    • This preptin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human p16 ELISA Kit

    201-12-1638 96 tests
    EUR 440
    • This p16 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.