Human PES1(Pescadillo Homolog 1) ELISA Kit

Human PES1(Pescadillo Homolog 1) ELISA Kit

To Order Contact us: 

    Human Pescadillo Homolog 1 (PES1) ELISA Kit
    SEK173Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pescadillo Homolog 1 (PES1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pescadillo Homolog 1 (PES1) in Tissue homogenates, cell lysates and other biological fluids.
    Human Pescadillo Homolog 1 (PES1) ELISA Kit
    SEK173Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pescadillo Homolog 1 (PES1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pescadillo Homolog 1 (PES1) in Tissue homogenates, cell lysates and other biological fluids.
    Human Pescadillo Homolog 1 (PES1) ELISA Kit
    4-SEK173Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Pescadillo Homolog 1 elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Pescadillo Homolog 1 (PES1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Human Pescadillo homolog, PES1 ELISA KIT
    ELI-44895h 96 Tests
    EUR 824
    Pescadillo Homolog 1 (PES1) Antibody
    20-abx128179
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Pescadillo Homolog 1 (PES1) Antibody
    20-abx174013
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Recombinant Pescadillo Homolog 1 (PES1)
    4-RPK173Hu01
    • EUR 494.24
    • EUR 235.00
    • EUR 1578.40
    • EUR 592.80
    • EUR 1085.60
    • EUR 394.00
    • EUR 3796.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: O00541
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 51.8kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Pescadillo Homolog 1 expressed in: E.coli
    Human Pescadillo Homolog 1 (PES1) Protein
    20-abx167019
    • EUR 690.00
    • EUR 286.00
    • EUR 2124.00
    • EUR 815.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Mouse Pescadillo homolog, Pes1 ELISA KIT
    ELI-43689m 96 Tests
    EUR 865
    Human Pescadillo Homolog 1 (PES1) CLIA Kit
    20-abx495831
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human PES1 (Pescadillo Homolog 1)
    ELK5001 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Pescadillo Homolog 1 (PES1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pescad
    • Show more
    Description: A sandwich ELISA kit for detection of Pescadillo Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Pescadillo homolog (PES1)
    KTE61247-48T 48T
    EUR 332
    • PES1 is abnormally elevated in malignant tumors of astrocytic origin. It is a strongly conserved gene containing a BRCT domain that is essential for the activity of this gene product. The gene plays a crucial role in cell proliferation and may be nec
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Pescadillo homolog (PES1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Pescadillo homolog (PES1)
    KTE61247-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • PES1 is abnormally elevated in malignant tumors of astrocytic origin. It is a strongly conserved gene containing a BRCT domain that is essential for the activity of this gene product. The gene plays a crucial role in cell proliferation and may be nec
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Pescadillo homolog (PES1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Pescadillo homolog (PES1)
    KTE61247-96T 96T
    EUR 539
    • PES1 is abnormally elevated in malignant tumors of astrocytic origin. It is a strongly conserved gene containing a BRCT domain that is essential for the activity of this gene product. The gene plays a crucial role in cell proliferation and may be nec
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Pescadillo homolog (PES1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human)
    4-PAK173Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PES1 (Met1~Ser415)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1)
    Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), APC
    4-PAK173Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PES1 (Met1~Ser415)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with APC.
    Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), Biotinylated
    4-PAK173Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PES1 (Met1~Ser415)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with Biotin.
    Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), Cy3
    4-PAK173Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PES1 (Met1~Ser415)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with Cy3.
    Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), FITC
    4-PAK173Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PES1 (Met1~Ser415)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with FITC.
    Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), HRP
    4-PAK173Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PES1 (Met1~Ser415)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with HRP.
    Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), PE
    4-PAK173Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PES1 (Met1~Ser415)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with PE.
    Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), APC-Cy7
    4-PAK173Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PES1 (Met1~Ser415)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with APC-Cy7.
    Pescadillo Ribosomal Biogenesis Factor 1 (Pes1) Antibody
    20-abx114415
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody
    abx030785-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody
    abx030785-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody
    20-abx318092
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody
    abx236324-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody (HRP)
    20-abx317086
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody (FITC)
    20-abx317087
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody (Biotin)
    20-abx317088
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Pes1/ Rat Pes1 ELISA Kit
    ELI-45915r 96 Tests
    EUR 886
    PES1 ELISA KIT|Human
    EF001685 96 Tests
    EUR 689
    PES1 ELISA Kit (Human) (OKCD00595)
    OKCD00595 96 Wells
    EUR 831
    Description: Description of target: Component of the PeBoW complex, which is required for maturation of 28S and 5.8S ribosomal RNAs and formation of the 60S ribosome.UniRule annotation <p>Manual validated information which has been generated by the UniProtKB automatic annotation system.</p> <p><a href="/manual/evidences#ECO:0000255">More…</a></p> Manual assertion according to rulesiHAMAP-Rule:MF_030283 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.9"Dominant-negative Pes1 mutants inhibit ribosomal RNA processing and cell proliferation via incorporation into the PeBoW-complex."_x005F_x005F_x000D_Grimm T., Hoelzel M., Rohrmoser M., Harasim T., Malamoussi A., Gruber-Eber A., Kremmer E., Eick D._x005F_x005F_x000D_Nucleic Acids Res. 34:3030-3043(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH BOP1 AND WDR12, SUBCELLULAR LOCATION.Ref.10"Interdependence of Pes1, Bop1, and WDR12 controls nucleolar localization and assembly of the PeBoW complex required for maturation of the 60S ribosomal subunit."_x005F_x005F_x000D_Rohrmoser M., Hoelzel M., Grimm T., Malamoussi A., Harasim T., Orban M., Pfisterer I., Gruber-Eber A., Kremmer E., Eick D._x005F_x005F_x000D_Mol. Cell. Biol. 27:3682-3694(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH BOP1 AND WDR12.Ref.11"The BRCT domain of mammalian Pes1 is crucial for nucleolar localization and rRNA processing."_x005F_x005F_x000D_Hoelzel M., Grimm T., Rohrmoser M., Malamoussi A., Harasim T., Gruber-Eber A., Kremmer E., Eick D._x005F_x005F_x000D_Nucleic Acids Res. 35:789-800(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH BOP1 AND WDR12, SUBCELLULAR LOCATION, MUTAGENESIS OF PHE-327; ILE-347; ARG-380 AND TRP-397. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL
    Pescadillo Antibody
    abx432062-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    anti-Pescadillo
    YF-PA17912 50 ug
    EUR 363
    Description: Mouse polyclonal to Pescadillo
    anti-Pescadillo
    YF-PA17913 50 ul
    EUR 363
    Description: Mouse polyclonal to Pescadillo
    anti-Pescadillo
    YF-PA17914 50 ug
    EUR 363
    Description: Mouse polyclonal to Pescadillo
    Anti-Pescadillo antibody
    STJ70378 100 µg
    EUR 359
    PES1 siRNA
    20-abx903944
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PES1 siRNA
    20-abx928258
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PES1 siRNA
    20-abx928259
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PES1 antibody
    70R-3107 50 ug
    EUR 467
    Description: Rabbit polyclonal PES1 antibody
    PES1 antibody
    70R-19216 50 ul
    EUR 435
    Description: Rabbit polyclonal PES1 antibody
    PES1 Antibody
    1-CSB-PA017791GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against PES1. Recognizes PES1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    PES1 Antibody
    1-CSB-PA017791LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PES1. Recognizes PES1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200
    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes
    Human PES1 shRNA Plasmid
    20-abx958299
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    PES1 Recombinant Protein (Human)
    RP023110 100 ug Ask for price
    mRNAExpress mRNA Synthesis kit (5 reactions)
    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products
    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools
    PES1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1628302 1.0 ug DNA
    EUR 154
    PES1 cloning plasmid
    CSB-CL017791HU-10ug 10ug
    EUR 604
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1767
    • Sequence: atgggaggccttgagaagaagaagtatgaacgaggctcggccaccaactacatcacccggaacaaagcccggaagaagctccagctgagcttggctgactttaggcggctgtgcattctgaagggcatttatccccatgaacccaaacacaagaagaaggttaacaagggttcta
    • Show more
    Description: A cloning plasmid for the PES1 gene.
    anti- PES1 antibody
    FNab06324 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:5000
    • IHC: 1:20-1:200
    • Immunogen: pescadillo homolog 1, containing BRCT domain(zebrafish)
    • Uniprot ID: O00541
    • Research Area: Metabolism
    Description: Antibody raised against PES1
    PES1 Rabbit pAb
    A14506-100ul 100 ul
    EUR 308
    PES1 Rabbit pAb
    A14506-200ul 200 ul
    EUR 459
    PES1 Rabbit pAb
    A14506-20ul 20 ul
    EUR 183
    PES1 Rabbit pAb
    A14506-50ul 50 ul
    EUR 223
    PES1 Blocking Peptide
    33R-4489 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PES1 antibody, catalog no. 70R-3107
    PES1 Polyclonal Antibody
    28606-100ul 100ul
    EUR 252
    PES1 Polyclonal Antibody
    28606-50ul 50ul
    EUR 187
    Anti-PES1 antibody
    PAab06324 100 ug
    EUR 386
    Anti-PES1 antibody
    STJ116717 100 µl
    EUR 277
    Description: This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9.
    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools
    PES1 ORF Vector (Human) (pORF)
    ORF007704 1.0 ug DNA
    EUR 95
    Anti-CELSR3/Flamingo Homolog 1 Antibody
    A07204-1 100ul
    EUR 397
    Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.
    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9
    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools
    Human Notch Homolog 1 ELISA kit
    E01N0594-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Notch Homolog 1 ELISA kit
    E01N0594-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Notch Homolog 1 ELISA kit
    E01N0594-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN410A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools
    PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
    PIN412A-KIT 1 Kit
    EUR 4335
    • Category: PinPoint Integrase Tools
    Polyclonal Goat Anti-Pescadillo Antibody
    APG00241G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Pescadillo . This antibody is tested and proven to work in the following applications:
    AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
    AP-STR-KIT-1 1/pk
    EUR 355
    Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller
    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
    PES1 Polyclonal Conjugated Antibody
    C28606 100ul
    EUR 397
    Mouse PES1 shRNA Plasmid
    20-abx975318
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Rat PES1 shRNA Plasmid
    20-abx988405
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    PES1 Antibody, HRP conjugated
    1-CSB-PA017791LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PES1. Recognizes PES1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    PES1 Antibody, FITC conjugated
    1-CSB-PA017791LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PES1. Recognizes PES1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    PES1 Antibody, Biotin conjugated
    1-CSB-PA017791LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PES1. Recognizes PES1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    PES1 Recombinant Protein (Rat)
    RP220061 100 ug Ask for price
    pCMV-SPORT6-Pes1-m
    PVT18832 2 ug
    EUR 231
    PES1 Recombinant Protein (Mouse)
    RP161348 100 ug Ask for price
    Column Packing Kit
    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
    Pes1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4779202 1.0 ug DNA
    EUR 154
    Pes1 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K7130902 1.0 ug DNA
    EUR 154
    Human Glutaredoxin-1 AssayMax ELISA Kit
    EG2153-1 96 Well Plate
    EUR 417
    Human Complexin-1 AssayMax ELISA Kit
    EC3505-1 96 Well Plate
    EUR 417
    Human Hexokinase-1 AssayMax ELISA Kit
    EH3101-1 96 Well Plate
    EUR 477
    PES1 sgRNA CRISPR Lentivector set (Human)
    K1628301 3 x 1.0 ug
    EUR 339
    PCR Mycoplasma Detection Kit
    M034-Kit Kit
    EUR 266
    Human Dachshund Homolog 1 (DACH1) ELISA Kit
    abx556324-96tests 96 tests
    EUR 668
    • Shipped within 1-3 weeks.
    Human Roundabout homolog 1 (ROBO1) ELISA Kit
    abx556329-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Frizzled Homolog 1 (FZD1) ELISA Kit
    abx571378-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Dickkopf 1 Homolog (DKK1) ELISA Kit
    abx576304-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.
    Human DAB1/ Disabled homolog 1 ELISA Kit
    E0654Hu 1 Kit
    EUR 605
    Human Protein pellino homolog 1 ELISA kit
    E01P0173-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Protein pellino homolog 1 ELISA kit
    E01P0173-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Protein pellino homolog 1 ELISA kit
    E01P0173-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Achaete scute homolog 1 ELISA kit
    E01A0079-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Achaete scute homolog 1 ELISA kit
    E01A0079-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Crumbs homolog 1(CRB1) ELISA kit
    E01C2038-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Crumbs homolog 1(CRB1) ELISA kit
    E01C2038-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Crumbs homolog 1(CRB1) ELISA kit
    E01C2038-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    ELISA kit for Human Disabled homolog 1
    EK3039 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
    ELISA kit for Human Roundabout homolog 1
    EK4583 96 tests
    EUR 603
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Roundabout homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
    ELISA kit for Human Ovostatin homolog 1
    EK5036 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ovostatin homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.
    Human OVOS1/ Ovostatin homolog 1 ELISA Kit
    E1844Hu 1 Kit
    EUR 605
    Human ROBO1/ Roundabout homolog 1 ELISA Kit
    E2165Hu 1 Kit
    EUR 605
    Human DAB1(Disabled homolog 1) ELISA Kit
    EH1419 96T
    EUR 567.6
    • Detection range: 0.312-20 ng/ml
    • Uniprot ID: O75553
    • Alias: DAB1/Disabled homolog 1
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
    Human OVOS1(Ovostatin homolog 1) ELISA Kit
    EH2509 96T
    EUR 567.6
    • Detection range: 15.6-1000 pg/ml
    • Uniprot ID: Q6IE37
    • Alias: OVOS1
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml
    Human Nanos homolog 1, NANOS1 ELISA KIT
    ELI-20656h 96 Tests
    EUR 824
    Human Dapper homolog 1, DACT1 ELISA KIT
    ELI-26384h 96 Tests
    EUR 824
    Human Disabled homolog 1, DAB1 ELISA KIT
    ELI-04118h 96 Tests
    EUR 824
    Human Pumilio homolog 1, PUM1 ELISA KIT
    ELI-15545h 96 Tests
    EUR 824
    Human Pygopus homolog 1, PYGO1 ELISA KIT
    ELI-16773h 96 Tests
    EUR 824
    Human Dachshund homolog 1, DACH1 ELISA KIT
    ELI-09038h 96 Tests
    EUR 824
    Human Roundabout homolog 1, ROBO1 ELISA KIT
    ELI-53163h 96 Tests
    EUR 824
    Human Crumbs homolog 1, CRB1 ELISA KIT
    ELI-33725h 96 Tests
    EUR 824
    Human Ovostatin homolog 1, OVOS1 ELISA KIT
    ELI-37024h 96 Tests
    EUR 824
    Human Nitrilase homolog 1, NIT1 ELISA KIT
    ELI-39611h 96 Tests
    EUR 824
    Human Teashirt homolog 1, TSHZ1 ELISA KIT
    ELI-51216h 96 Tests
    EUR 824
    Human Dickkopf 1 Homolog (DKK1) ELISA Kit
    20-abx151322
    • EUR 6642.00
    • EUR 441.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 24 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Frizzled Homolog 1 (FZD1) ELISA Kit
    20-abx151586
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human MutL Homolog 1 (MLH1) ELISA Kit
    20-abx152407
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Slingshot Homolog 1 (SSH1) ELISA Kit
    20-abx153111
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Slit Homolog 1 (Slit1) ELISA Kit
    20-abx153114
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Snail Homolog 1 (SNAI1) ELISA Kit
    20-abx153126
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Dickkopf 1 Homolog (DKK1) ELISA Kit
    abx054998-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.
    Human Nitrilase homolog 1 (NIT1) ELISA Kit
    abx381810-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Notchless Homolog 1 (NLE1) ELISA Kit
    abx381821-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Chromobox Homolog 1 (CBX1) ELISA Kit
    20-abx386315
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.
    Human Ovostatin homolog 1 (OVOS1) ELISA Kit
    abx251879-96tests 96 tests
    EUR 739
    • Shipped within 5-12 working days.
    Human Dickkopf 1 Homolog (DKK1) ELISA Kit
    abx250378-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.
    Human Frizzled Homolog 1 (FZD1) ELISA Kit
    abx250519-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.