Human PES1(Pescadillo Homolog 1) ELISA Kit

Human PES1(Pescadillo Homolog 1) ELISA Kit

To Order Contact us: 

Human Pescadillo Homolog 1 (PES1) ELISA Kit
SEK173Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pescadillo Homolog 1 (PES1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pescadillo Homolog 1 (PES1) in Tissue homogenates, cell lysates and other biological fluids.

Human Pescadillo Homolog 1 (PES1) ELISA Kit
SEK173Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Pescadillo Homolog 1 (PES1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Pescadillo Homolog 1 (PES1) in Tissue homogenates, cell lysates and other biological fluids.

Human Pescadillo Homolog 1 (PES1) ELISA Kit
4-SEK173Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Pescadillo Homolog 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Pescadillo Homolog 1 (PES1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Pescadillo homolog, PES1 ELISA KIT
ELI-44895h	Lifescience Market	96 Tests	EUR 824

Pescadillo Homolog 1 (PES1) Antibody
20-abx128179	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Pescadillo Homolog 1 (PES1) Antibody
20-abx174013	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Pescadillo Homolog 1 (PES1)
4-RPK173Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O00541 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 51.8kDa Isoelectric Point: Inquire
Description: Recombinant Human Pescadillo Homolog 1 expressed in: E.coli

Human Pescadillo Homolog 1 (PES1) Protein
20-abx167019	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Pescadillo homolog, Pes1 ELISA KIT
ELI-43689m	Lifescience Market	96 Tests	EUR 865

Human Pescadillo Homolog 1 (PES1) CLIA Kit
20-abx495831	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human PES1 (Pescadillo Homolog 1)
ELK5001	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Pescadillo Homolog 1 (PES1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Pescad Show more
Description: A sandwich ELISA kit for detection of Pescadillo Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Pescadillo homolog (PES1)
KTE61247-48T	Abbkine	48T	EUR 332
PES1 is abnormally elevated in malignant tumors of astrocytic origin. It is a strongly conserved gene containing a BRCT domain that is essential for the activity of this gene product. The gene plays a crucial role in cell proliferation and may be nec Show more
Description: Quantitative sandwich ELISA for measuring Human Pescadillo homolog (PES1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Pescadillo homolog (PES1)
KTE61247-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
PES1 is abnormally elevated in malignant tumors of astrocytic origin. It is a strongly conserved gene containing a BRCT domain that is essential for the activity of this gene product. The gene plays a crucial role in cell proliferation and may be nec Show more
Description: Quantitative sandwich ELISA for measuring Human Pescadillo homolog (PES1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Pescadillo homolog (PES1)
KTE61247-96T	Abbkine	96T	EUR 539
PES1 is abnormally elevated in malignant tumors of astrocytic origin. It is a strongly conserved gene containing a BRCT domain that is essential for the activity of this gene product. The gene plays a crucial role in cell proliferation and may be nec Show more
Description: Quantitative sandwich ELISA for measuring Human Pescadillo homolog (PES1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human)
4-PAK173Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PES1 (Met1~Ser415) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1)

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), APC
4-PAK173Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PES1 (Met1~Ser415) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with APC.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), Biotinylated
4-PAK173Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PES1 (Met1~Ser415) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with Biotin.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), Cy3
4-PAK173Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PES1 (Met1~Ser415) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with Cy3.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), FITC
4-PAK173Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PES1 (Met1~Ser415) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with FITC.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), HRP
4-PAK173Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PES1 (Met1~Ser415) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with HRP.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), PE
4-PAK173Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PES1 (Met1~Ser415) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with PE.

Pescadillo Homolog 1 (PES1) Polyclonal Antibody (Human), APC-Cy7
4-PAK173Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: PES1 (Met1~Ser415) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Pescadillo Homolog 1 (PES1). This antibody is labeled with APC-Cy7.

Pescadillo Ribosomal Biogenesis Factor 1 (Pes1) Antibody
20-abx114415	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody
abx030785-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody
abx030785-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody
abx236324-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody
20-abx318092	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody (HRP)
20-abx317086	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody (FITC)
20-abx317087	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pescadillo Ribosomal Biogenesis Factor 1 (PES1) Antibody (Biotin)
20-abx317088	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Pes1/ Rat Pes1 ELISA Kit
ELI-45915r	Lifescience Market	96 Tests	EUR 886

PES1 ELISA KIT|Human
EF001685	Lifescience Market	96 Tests	EUR 689

PES1 ELISA Kit (Human) (OKCD00595)
OKCD00595	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Component of the PeBoW complex, which is required for maturation of 28S and 5.8S ribosomal RNAs and formation of the 60S ribosome.UniRule annotation <p>Manual validated information which has been generated by the UniProtKB automatic annotation system.</p> <p><a href="/manual/evidences#ECO:0000255">More…</a></p> Manual assertion according to rulesiHAMAP-Rule:MF_030283 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.9"Dominant-negative Pes1 mutants inhibit ribosomal RNA processing and cell proliferation via incorporation into the PeBoW-complex."_x005F_x005F_x000D_Grimm T., Hoelzel M., Rohrmoser M., Harasim T., Malamoussi A., Gruber-Eber A., Kremmer E., Eick D._x005F_x005F_x000D_Nucleic Acids Res. 34:3030-3043(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH BOP1 AND WDR12, SUBCELLULAR LOCATION.Ref.10"Interdependence of Pes1, Bop1, and WDR12 controls nucleolar localization and assembly of the PeBoW complex required for maturation of the 60S ribosomal subunit."_x005F_x005F_x000D_Rohrmoser M., Hoelzel M., Grimm T., Malamoussi A., Harasim T., Orban M., Pfisterer I., Gruber-Eber A., Kremmer E., Eick D._x005F_x005F_x000D_Mol. Cell. Biol. 27:3682-3694(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH BOP1 AND WDR12.Ref.11"The BRCT domain of mammalian Pes1 is crucial for nucleolar localization and rRNA processing."_x005F_x005F_x000D_Hoelzel M., Grimm T., Rohrmoser M., Malamoussi A., Harasim T., Gruber-Eber A., Kremmer E., Eick D._x005F_x005F_x000D_Nucleic Acids Res. 35:789-800(2007) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH BOP1 AND WDR12, SUBCELLULAR LOCATION, MUTAGENESIS OF PHE-327; ILE-347; ARG-380 AND TRP-397. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.063 ng/mL

Pescadillo Antibody
abx432062-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

anti-Pescadillo
YF-PA17912	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Pescadillo

anti-Pescadillo
YF-PA17913	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Pescadillo

anti-Pescadillo
YF-PA17914	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Pescadillo

Anti-Pescadillo antibody
STJ70378	St John's Laboratory	100 µg	EUR 359

PES1 antibody
70R-19216	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PES1 antibody

PES1 antibody
70R-3107	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal PES1 antibody

PES1 Antibody
1-CSB-PA017791GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PES1. Recognizes PES1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PES1 Antibody
1-CSB-PA017791LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PES1. Recognizes PES1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

PES1 siRNA
20-abx903944	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PES1 siRNA
20-abx928258	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PES1 siRNA
20-abx928259	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Human PES1 shRNA Plasmid
20-abx958299	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PES1 Recombinant Protein (Human)
RP023110	ABM	100 ug	Ask for price

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PES1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1628302	ABM	1.0 ug DNA	EUR 154

PES1 Polyclonal Antibody
28606-100ul	SAB	100ul	EUR 252

PES1 Polyclonal Antibody
28606-50ul	SAB	50ul	EUR 187

PES1 Rabbit pAb
A14506-100ul	Abclonal	100 ul	EUR 308

PES1 Rabbit pAb
A14506-200ul	Abclonal	200 ul	EUR 459

PES1 Rabbit pAb
A14506-20ul	Abclonal	20 ul	EUR 183

PES1 Rabbit pAb
A14506-50ul	Abclonal	50 ul	EUR 223

PES1 Blocking Peptide
33R-4489	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PES1 antibody, catalog no. 70R-3107

PES1 cloning plasmid
CSB-CL017791HU-10ug	Cusabio	10ug	EUR 604
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1767 Sequence: atgggaggccttgagaagaagaagtatgaacgaggctcggccaccaactacatcacccggaacaaagcccggaagaagctccagctgagcttggctgactttaggcggctgtgcattctgaagggcatttatccccatgaacccaaacacaagaagaaggttaacaagggttcta Show more
Description: A cloning plasmid for the PES1 gene.

anti- PES1 antibody
FNab06324	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 Immunogen: pescadillo homolog 1, containing BRCT domain(zebrafish) Uniprot ID: O00541 Research Area: Metabolism
Description: Antibody raised against PES1

Anti-PES1 antibody
PAab06324	Lifescience Market	100 ug	EUR 386

Anti-PES1 antibody
STJ116717	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PES1 ORF Vector (Human) (pORF)
ORF007704	ABM	1.0 ug DNA	EUR 95

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human Notch Homolog 1 ELISA kit
E01N0594-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit
E01N0594-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit
E01N0594-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Polyclonal Goat Anti-Pescadillo Antibody
APG00241G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-Pescadillo . This antibody is tested and proven to work in the following applications:

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

PES1 Antibody, HRP conjugated
1-CSB-PA017791LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PES1. Recognizes PES1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PES1 Antibody, FITC conjugated
1-CSB-PA017791LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PES1. Recognizes PES1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PES1 Antibody, Biotin conjugated
1-CSB-PA017791LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PES1. Recognizes PES1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Rat PES1 shRNA Plasmid
20-abx988405	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse PES1 shRNA Plasmid
20-abx975318	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PES1 Polyclonal Conjugated Antibody
C28606	SAB	100ul	EUR 397

pCMV-SPORT6-Pes1-m
PVT18832	Lifescience Market	2 ug	EUR 231

PES1 Recombinant Protein (Mouse)
RP161348	ABM	100 ug	Ask for price

PES1 Recombinant Protein (Rat)
RP220061	ABM	100 ug	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Pes1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4779202	ABM	1.0 ug DNA	EUR 154

Pes1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7130902	ABM	1.0 ug DNA	EUR 154

PES1 sgRNA CRISPR Lentivector set (Human)
K1628301	ABM	3 x 1.0 ug	EUR 339

Human Frizzled Homolog 1 (FZD1)ELISA Kit
201-12-2369	SunredBio	96 tests	EUR 440
This Frizzled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Slit Homolog 1 (Slit1)ELISA Kit
201-12-2565	SunredBio	96 tests	EUR 440
This Slit Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Diaphanous Homolog 1 (DIAPH1)ELISA Kit
201-12-2655	SunredBio	96 tests	EUR 440
This Diaphanous Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Disabled Homolog 1 (DAB1)ELISA Kit
201-12-2657	SunredBio	96 tests	EUR 440
This Disabled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Atonal Homolog 1 (ATOH1)ELISA Kit
201-12-2838	SunredBio	96 tests	EUR 440
This Atonal Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Chromobox Homolog 1 (CBX1)ELISA Kit
201-12-2894	SunredBio	96 tests	EUR 440
This Chromobox Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit
DLR-SNAI1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Snail Homolog 1 (SNAI1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit
DLR-SNAI1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Snail Homolog 1 (SNAI1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Slingshot Homolog 1 (SSH1) ELISA Kit
DLR-SSH1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids.

Human Slingshot Homolog 1 (SSH1) ELISA Kit
DLR-SSH1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids.

Human MutL Homolog 1 (MLH1) ELISA Kit
DLR-MLH1-Hu-48T	DL Develop	48T	EUR 517
Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human MutL Homolog 1 (MLH1) ELISA Kit
DLR-MLH1-Hu-96T	DL Develop	96T	EUR 673
Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
DLR-DIAPH1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Diaphanous Homolog 1 (DIAPH1) in samples from tissue homogenates or other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
DLR-DIAPH1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Diaphanous Homolog 1 (DIAPH1) in samples from tissue homogenates or other biological fluids.

Human Frizzled Homolog 1 (FZD1) ELISA Kit
DLR-FZD1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids.

Human Frizzled Homolog 1 (FZD1) ELISA Kit
DLR-FZD1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids.

Human Roundabout homolog 1(ROBO1) ELISA kit
CSB-EL020054HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1 (ROBO1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Roundabout homolog 1(ROBO1) ELISA kit
1-CSB-EL020054HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1(ROBO1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human DAB1/ Disabled homolog 1 ELISA Kit
E0654Hu	Sunlong	1 Kit	EUR 605

Human Achaete scute homolog 1 ELISA kit
E01A0079-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Achaete scute homolog 1 ELISA kit
E01A0079-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Achaete scute homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit
E01P0173-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit
E01P0173-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Protein pellino homolog 1 ELISA kit
E01P0173-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Crumbs homolog 1(CRB1) ELISA kit
E01C2038-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Crumbs homolog 1(CRB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dickkopf 1 Homolog (DKK1) ELISA Kit
abx054998-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Dickkopf 1 Homolog (DKK1) ELISA Kit
20-abx151322	Abbexa	EUR 6642.00 EUR 441.00 EUR 3542.00 EUR 825.00	10 × 96 tests 24 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Frizzled Homolog 1 (FZD1) ELISA Kit
20-abx151586	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human MutL Homolog 1 (MLH1) ELISA Kit
20-abx152407	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Slingshot Homolog 1 (SSH1) ELISA Kit
20-abx153111	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Slit Homolog 1 (Slit1) ELISA Kit
20-abx153114	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Snail Homolog 1 (SNAI1) ELISA Kit
20-abx153126	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Dickkopf 1 Homolog (DKK1) ELISA Kit
abx250378-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Frizzled Homolog 1 (FZD1) ELISA Kit
abx250519-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human Ovostatin homolog 1 (OVOS1) ELISA Kit
abx251879-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Human Ovostatin homolog 1
EK5036	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ovostatin homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human OVOS1(Ovostatin homolog 1) ELISA Kit
EH2509	FN Test	96T	EUR 567.6
Detection range: 15.6-1000 pg/ml Uniprot ID: Q6IE37 Alias: OVOS1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

ELISA kit for Human Disabled homolog 1
EK3039	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Disabled homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Roundabout homolog 1
EK4583	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Roundabout homolog 1 in samples from serum, plasma, tissue homogenates and other biological fluids.