Human THBS3(Thrombospondin 3) ELISA Kit

Human THBS3(Thrombospondin 3) ELISA Kit

To Order Contact us: 

Human Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Hu-48Tests 48 Tests
EUR 544
Human Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Hu-96Tests 96 Tests
EUR 756
Human Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Hu-48Tests 48 Tests
EUR 521
Human Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Hu-96Tests 96 Tests
EUR 723
Mouse Thrombospondin 3 (THBS3) ELISA Kit
DLR-THBS3-Mu-48T 48T
EUR 527
  • Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
DLR-THBS3-Mu-96T 96T
EUR 688
  • Should the Mouse Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 3 (THBS3) in samples from plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Mu-48Tests 48 Tests
EUR 557
Mouse Thrombospondin 3 (THBS3) ELISA Kit
RDR-THBS3-Mu-96Tests 96 Tests
EUR 774
Mouse Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Mu-48Tests 48 Tests
EUR 533
Mouse Thrombospondin 3 (THBS3) ELISA Kit
RD-THBS3-Mu-96Tests 96 Tests
EUR 740
Human Thrombospondin 3 (THBS3) ELISA Kit
20-abx156876
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Thrombospondin 3 (THBS3) ELISA Kit
abx259888-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Thrombospondin- 3, THBS3 ELISA KIT
ELI-36583h 96 Tests
EUR 824
Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.
Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.
Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.
Human Thrombospondin 3 (THBS3) ELISA Kit
SED823Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma.
Human Thrombospondin 3 (THBS3) ELISA Kit
4-SED823Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
20-abx154756
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Mouse Thrombospondin- 3, Thbs3 ELISA KIT
ELI-17025m 96 Tests
EUR 865
Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
SED823Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma.
Mouse Thrombospondin 3 (THBS3) ELISA Kit
4-SED823Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species.
ELISA kit for Human THBS3 (Thrombospondin 3)
ELK5166 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Thrombospondin 3 (THBS3) CLIA Kit
20-abx494398
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Mouse Thrombospondin-3 (Thbs3)
1-CSB-EP023489MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 62.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in E.coli
Mouse Thrombospondin-3 (Thbs3)
1-CSB-YP023489MO
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in Yeast
Thrombospondin 3 (THBS3) Antibody
20-abx178573
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.
Thrombospondin 3 (THBS3) Antibody
20-abx178574
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx110655
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx110656
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx116967
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx123257
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx128997
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Thrombospondin 3 (THBS3) Antibody
abx030681-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
abx030681-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
abx238675-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Thrombospondin 3 (THBS3) Antibody
20-abx320416
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody
abx431668-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Recombinant Thrombospondin 3 (THBS3)
4-RPD823Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P49746
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 58.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Thrombospondin 3 expressed in: E.coli
Human Thrombospondin 3 (THBS3) Protein
20-abx166577
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
ELISA kit for Mouse THBS3 (Thrombospondin 3)
ELK6457 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Mouse Thrombospondin 3 (THBS3) CLIA Kit
20-abx494399
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
Thrombospondin 3 (THBS3) Antibody (Biotin)
20-abx106391
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody (Biotin)
20-abx106392
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody (FITC)
20-abx107803
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody (FITC)
20-abx107804
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody (HRP)
20-abx109221
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Thrombospondin 3 (THBS3) Antibody (HRP)
20-abx109222
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Mouse Thrombospondin 3 (THBS3) Protein
20-abx655225
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Mouse Thrombospondin 3 (THBS3) Protein
20-abx655226
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human)
4-PAD823Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3)
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC
4-PAD823Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Biotinylated
4-PAD823Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Biotin.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Cy3
4-PAD823Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Cy3.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), FITC
4-PAD823Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with FITC.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), HRP
4-PAD823Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with HRP.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), PE
4-PAD823Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with PE.
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC-Cy7
4-PAD823Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: THBS3 (Asp670~Cys921)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC-Cy7.
Polyclonal THBS3 / Thrombospondin 3 Antibody (C-Terminus)
AMM08184G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human THBS3 / Thrombospondin 3 (C-Terminus). This antibody is tested and proven to work in the following applications:
Thrombospondin 3 ELISA KIT|Human
EF003592 96 Tests
EUR 689
Human Thrombospondin 3 (TSP-3)ELISA Kit
201-12-2387 96 tests
EUR 440
  • This Thrombospondin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Thrombospondin 3(TSP-3)ELISA Kit
QY-E00634 96T
EUR 361
THBS3 antibody
70R-21720 50 ul
EUR 435
Description: Rabbit polyclonal THBS3 antibody
Thbs3 Antibody
1-CSB-PA023489DA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA
Thbs3 Antibody
1-CSB-PA023489EA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000
THBS3 Antibody
1-CSB-PA023489ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
THBS3 Antibody
1-CSB-PA023489GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB
THBS3 siRNA
20-abx936680
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
THBS3 siRNA
20-abx936681
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202
Human THBS3 shRNA Plasmid
20-abx954831
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human Thrombospondin 1 ELISA kit
E01T0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 1 ELISA kit
E01T0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 1 ELISA kit
E01T0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin-2 ELISA kit
LF-EK50605 1×96T
EUR 648
THBS3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2368904 1.0 ug DNA
EUR 154
THBS3 cloning plasmid
CSB-CL023489HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1458
  • Sequence: ATGGACAACAACAAACACTGCAAACAGGACAACTGCCTTTTGACACCCAACTCTGGGCAGGAAGATGCTGATAATGATGGTGTGGGGGACCAGTGTGATGATGATGCTGATGGGGATGGGATCAAGAATGTTGAGGACAACTGCCGGCTGTTCCCCAACAAAGACCAGCAGAACT
  • Show more
Description: A cloning plasmid for the THBS3 gene.
Thbs3 Polyclonal Antibody
A57726 100 µg
EUR 570.55
Description: fast delivery possible
Thbs3 Polyclonal Antibody
A57777 100 µg
EUR 570.55
Description: Ask the seller for details
THBS3 Rabbit pAb
A3641-100ul 100 ul
EUR 308
THBS3 Rabbit pAb
A3641-200ul 200 ul
EUR 459
THBS3 Rabbit pAb
A3641-20ul 20 ul
EUR 183
THBS3 Rabbit pAb
A3641-50ul 50 ul
EUR 223
Anti-THBS3 antibody
STJ25845 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants.
Anti-THBS3 antibody
STJ71847 100 µg
EUR 359
FSH (Human Follicle-stimulating hormone) ELISA test
3 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of FSH (Human Follicle-stimulating hormone)
THBS3 ORF Vector (Human) (pORF)
ORF014707 1.0 ug DNA
EUR 354
Human Thrombospondin 1 (THBS1) ELISA Kit
DLR-THBS1-Hu-48T 48T
EUR 479
  • Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma.
Human Thrombospondin 1 (THBS1) ELISA Kit
DLR-THBS1-Hu-96T 96T
EUR 621
  • Should the Human Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 1 (THBS1) in samples from plasma.
Human Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Hu-48T 48T
EUR 387
  • Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.
Human Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Hu-96T 96T
EUR 494
  • Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.
Human Thrombospondin 4 (THBS4) ELISA Kit
DLR-THBS4-Hu-48T 48T
EUR 517
  • Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids.
Human Thrombospondin 4 (THBS4) ELISA Kit
DLR-THBS4-Hu-96T 96T
EUR 673
  • Should the Human Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 4 (THBS4) in samples from serum, plasma or other biological fluids.
Human Thrombospondin-2(THBS2) ELISA kit
CSB-EL023488HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2 (THBS2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Thrombospondin-2(THBS2) ELISA kit
1-CSB-EL023488HU
  • EUR 602.00
  • EUR 4238.00
  • EUR 2256.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Thrombospondin-2(THBS2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Thrombospondin-4(THBS4) ELISA kit
CSB-EL023490HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4 (THBS4) in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Thrombospondin-4(THBS4) ELISA kit
1-CSB-EL023490HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Thrombospondin-4(THBS4) in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
Human Thrombospondin 1(THBS1) ELISA kit
E01T0686-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 1(THBS1) ELISA kit
E01T0686-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 1(THBS1) ELISA kit
E01T0686-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 2(THBS2) ELISA kit
E01T0687-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 2(THBS2) ELISA kit
E01T0687-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin 2(THBS2) ELISA kit
E01T0687-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Thrombospondin-2 (JAK2) ELISA Kit
abx050226-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.
Human Thrombospondin 1 (THBS1) ELISA Kit
abx052577-96tests 96 tests
EUR 786
  • Shipped within 5-10 working days.
Human Thrombospondin 1 (THBS1) ELISA Kit
20-abx153283
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Thrombospondin 2 (THBS2) ELISA Kit
20-abx153284
  • EUR 5311.00
  • EUR 2837.00
  • EUR 668.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Thrombospondin 4 (THBS4) ELISA Kit
20-abx153285
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human Thrombospondin 4 (THBS4) ELISA Kit
abx253753-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.
Human Thrombospondin 2 (THBS2) ELISA Kit
abx250162-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Thrombospondin 1 (THBS1) ELISA Kit
abx253325-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.
Human Thrombospondin 4 (THBS4) ELISA Kit
abx253326-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.
Human THBS1/ Thrombospondin-1 ELISA Kit
E2490Hu 1 Kit
EUR 537
Human THBS2/ Thrombospondin-2 ELISA Kit
E2491Hu 1 Kit
EUR 537
Human THBS4/ Thrombospondin-4 ELISA Kit
E2492Hu 1 Kit
EUR 571
Human THBS4(Thrombospondin-4) ELISA Kit
EH0795 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P35443
  • Alias: TSP-4(Thrombospondin-4)/THBS4
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
Human Thrombospondin- 1, THBS1 ELISA KIT
ELI-02195h 96 Tests
EUR 824
Human Thrombospondin- 2, THBS2 ELISA KIT
ELI-06100h 96 Tests
EUR 824
Human Thrombospondin 4 (THBS4) ELISA Kit
abx571192-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Thrombospondin 1 (THBS1) ELISA Kit
abx571959-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Thrombospondin 2 (THBS2) ELISA Kit
abx576059-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.
Human Thrombospondin-2 ELISA kit (4X96T)
LF-EK50606 4×96T
EUR 2201
Human Thrombospondin 1 (THBS1) ELISA Kit
RDR-THBS1-Hu-48Tests 48 Tests
EUR 500
Human Thrombospondin 1 (THBS1) ELISA Kit
RDR-THBS1-Hu-96Tests 96 Tests
EUR 692
Human Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Hu-48Tests 48 Tests
EUR 390
Human Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Hu-96Tests 96 Tests
EUR 536
Human Thrombospondin 4 (THBS4) ELISA Kit
RDR-THBS4-Hu-48Tests 48 Tests
EUR 544
Human Thrombospondin 4 (THBS4) ELISA Kit
RDR-THBS4-Hu-96Tests 96 Tests
EUR 756
Human Thrombospondin 1 ELISA Kit (THBS1)
RK02384 96 Tests
EUR 521
Human Thrombospondin 1 (THBS1) ELISA Kit
RD-THBS1-Hu-48Tests 48 Tests
EUR 478
Human Thrombospondin 1 (THBS1) ELISA Kit
RD-THBS1-Hu-96Tests 96 Tests
EUR 662
Human Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Hu-48Tests 48 Tests
EUR 374
Human Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Hu-96Tests 96 Tests
EUR 513
Human Thrombospondin 4 (THBS4) ELISA Kit
RD-THBS4-Hu-48Tests 48 Tests
EUR 521
Human Thrombospondin 4 (THBS4) ELISA Kit
RD-THBS4-Hu-96Tests 96 Tests
EUR 723
Human Thrombospondin 2 (THBS2) ELISA Kit
SED822Hu-10x96wellstestplate 10x96-wells test plate
EUR 3147.61
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.
Human Thrombospondin 2 (THBS2) ELISA Kit
SED822Hu-1x48wellstestplate 1x48-wells test plate
EUR 346.86
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.
Human Thrombospondin 2 (THBS2) ELISA Kit
SED822Hu-1x96wellstestplate 1x96-wells test plate
EUR 452.66
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.
Human Thrombospondin 2 (THBS2) ELISA Kit
SED822Hu-5x96wellstestplate 5x96-wells test plate
EUR 1736.97
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 2 (THBS2) in serum, plasma and other biological fluids.
Human Thrombospondin 2 (THBS2) ELISA Kit
4-SED822Hu
  • EUR 3198.00
  • EUR 1687.00
  • EUR 453.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 2 elisa. Alternative names of the recognized antigen: TSP2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 2 (THBS2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human Thrombospondin 4 (THBS4) ELISA Kit
SED824Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.
Human Thrombospondin 4 (THBS4) ELISA Kit
SED824Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.
Human Thrombospondin 4 (THBS4) ELISA Kit
SED824Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.
Human Thrombospondin 4 (THBS4) ELISA Kit
SED824Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 4 (THBS4) in Plasma.
Human Thrombospondin 4 (THBS4) ELISA Kit
4-SED824Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 4 elisa. Alternative names of the recognized antigen: TSP4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 4 (THBS4) in samples from Plasma with no significant corss-reactivity with analogues from other species.
Human Thrombospondin 1 (THBS1) ELISA Kit
SEA611Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.
Human Thrombospondin 1 (THBS1) ELISA Kit
SEA611Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.
Human Thrombospondin 1 (THBS1) ELISA Kit
SEA611Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.
Human Thrombospondin 1 (THBS1) ELISA Kit
SEA611Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 1 (THBS1) in plasma.
Human Thrombospondin 1 (THBS1) ELISA Kit
4-SEA611Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Thrombospondin 1 elisa. Alternative names of the recognized antigen: TSP1
  • Thrombospondin-1p180
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 1 (THBS1) in samples from plasma with no significant corss-reactivity with analogues from other species.
Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
Thbs3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4897004 1.0 ug DNA
EUR 154
Thbs3 3'UTR Luciferase Stable Cell Line
TU120448 1.0 ml Ask for price
Thbs3 3'UTR GFP Stable Cell Line
TU170448 1.0 ml Ask for price
THBS3 3'UTR GFP Stable Cell Line
TU075528 1.0 ml
EUR 1521
THBS3 3'UTR Luciferase Stable Cell Line
TU025528 1.0 ml
EUR 1521
Mouse THBS3 shRNA Plasmid
20-abx973102
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Thbs3 Antibody, HRP conjugated
1-CSB-PA023489DB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA
Thbs3 Antibody, FITC conjugated
1-CSB-PA023489DC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA
Thbs3 Antibody, Biotin conjugated
1-CSB-PA023489DD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA
Thbs3 Antibody, HRP conjugated
1-CSB-PA023489EB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA
Thbs3 Antibody, FITC conjugated
1-CSB-PA023489EC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA
Thbs3 Antibody, Biotin conjugated
1-CSB-PA023489ED01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA
Dr. P Kit-Solution 3
K2021010-3 50 ml
EUR 133
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.
Rat Thrombospondin 1 ELISA kit
E02T0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Thrombospondin 1 ELISA kit
E02T0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Thrombospondin 1 ELISA kit
E02T0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Thrombospondin 1 ELISA kit
E04T0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Thrombospondin 1 ELISA kit
E04T0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Thrombospondin 1 ELISA kit
E04T0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Thrombospondin 1 ELISA kit
E03T0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Thrombospondin 1 ELISA kit
E03T0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Thrombospondin 1 ELISA kit
E03T0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Thrombospondin 1 ELISA kit
E08T0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Thrombospondin 1 ELISA kit
E08T0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Thrombospondin 1 ELISA kit
E08T0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Thrombospondin 1 ELISA kit
E07T0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Thrombospondin 1 ELISA kit
E07T0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Thrombospondin 1 ELISA kit
E07T0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Thrombospondin 1 ELISA kit
E09T0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Thrombospondin 1 ELISA kit
E09T0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Thrombospondin 1 ELISA kit
E09T0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Thrombospondin 1 ELISA kit
E06T0763-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Thrombospondin 1 ELISA kit
E06T0763-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Thrombospondin 1 ELISA kit
E06T0763-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266
THBS3 sgRNA CRISPR Lentivector set (Human)
K2368901 3 x 1.0 ug
EUR 339
Human thrombospondin 1,TSP-1 ELISA Kit
201-12-1111 96 tests
EUR 440
  • This thrombospondin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Thrombospondin 2 (TSP-2)ELISA Kit
201-12-2386 96 tests
EUR 440
  • This Thrombospondin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human Thrombospondin 4 (TSP-4)ELISA Kit
201-12-2388 96 tests
EUR 440
  • This Thrombospondin 4 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Human TSP-1(Thrombospondin-1) ELISA Kit
EH3924 96T
EUR 524.1
  • Detection range: 3.125-200 ng/ml
  • Alias: TSP-1/THBS1/TSP-1/THBS/THBS-1/thrombospondin 1/thrombospondin-1p180/TSP1thrombospondin-1/TSPTSP-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml
ELISA kit for Human Thrombospondin-2 (THBS2)
EK0285 96 tests
EUR 712
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Thrombospondin-2 (THBS2) in samples from serum, plasma, tissue homogenates and other biological fluids.
Human TSP-2(Thrombospondin-2) ELISA Kit
EH0023 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: P35442
  • Alias: TSP-2(Thrombospondin-2)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml
ELISA kit for Human THBS4 (Thrombospondin 4)
ELK3767 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 4 (THBS4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 4 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human THBS2 (Thrombospondin 2)
ELK1335 1 plate of 96 wells
EUR 372
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 2 (THBS2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
ELISA kit for Human THBS1 (Thrombospondin 1)
ELK1685 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 1 (THBS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
  • Show more
Description: A sandwich ELISA kit for detection of Thrombospondin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human thrombospondin 1, TSP-1 ELISA Kit
CSB-E08763h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human thrombospondin 1, TSP-1 in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human thrombospondin 1, TSP-1 ELISA Kit
1-CSB-E08763h
  • EUR 602.00
  • EUR 4238.00
  • EUR 2256.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human thrombospondin 1, TSP-1 in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.