Human FNTa(Farnesyltransferase Alpha) ELISA Kit

Human FNTa(Farnesyltransferase Alpha) ELISA Kit

To Order Contact us: 

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
SEG487Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
SEG487Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
SEG487Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Alpha (FNTa) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Alpha (FNTa) in serum, plasma, tissue homogenates and other biological fluids.

Human Farnesyltransferase Alpha (FNTa) ELISA Kit
4-SEG487Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Farnesyltransferase Alpha elisa. Alternative names of the recognized antigen: FPTA PTAR2 PGGT1A Protein Prenyltransferase Alpha Subunit Repeat Containing 2 CAAX farnesyltransferase subunit alpha Ras proteins prenyltransferase subun Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Alpha (FNTa) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Farnesyltransferase Alpha (FNTA) Antibody
20-abx123732	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
20-abx112466	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTa) Antibody
20-abx128216	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx031598-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx031598-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx031599-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTA) Antibody
abx031599-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Farnesyltransferase Alpha (FNTa) Antibody
20-abx172331	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Farnesyltransferase Alpha (FNTA) Antibody
abx233180-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Farnesyltransferase Alpha (FNTa)
4-RPG487Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P49354 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 41.7KDa Isoelectric Point: Inquire
Description: Recombinant Human Farnesyltransferase Alpha expressed in: E.coli

Human Farnesyltransferase Alpha (FNTa) Protein
20-abx166599	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Farnesyltransferase alpha (FNTa) CLIA Kit
20-abx495216	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human FNTa (Farnesyltransferase Alpha)
ELK4902	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Alpha (FNT?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to F Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Alpha from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse)
4-PAG487Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa)

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), APC
4-PAG487Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with APC.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAG487Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with Biotin.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), Cy3
4-PAG487Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with Cy3.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), FITC
4-PAG487Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with FITC.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), HRP
4-PAG487Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with HRP.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), PE
4-PAG487Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with PE.

Farnesyltransferase Alpha (FNTa) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAG487Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: FNTa (Met51~Lys366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Farnesyltransferase Alpha (FNTa). This antibody is labeled with APC-Cy7.

Fnta/ Rat Fnta ELISA Kit
ELI-47317r	Lifescience Market	96 Tests	EUR 886

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human FNTA ELISA KIT
ELI-26701h	Lifescience Market	96 Tests	EUR 824

FNTA ELISA KIT|Human
EF009665	Lifescience Market	96 Tests	EUR 689

FNTA ELISA Kit (Human) (OKCD00703)
OKCD00703	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Essential subunit of both the farnesyltransferase and the geranylgeranyltransferase complex. Contributes to the transfer of a farnesyl or geranylgeranyl moiety from farnesyl or geranylgeranyl diphosphate to a cysteine at the fourth position from the C-terminus of several proteins having the C-terminal sequence Cys-aliphatic-aliphatic-X. May positively regulate neuromuscular junction development downstream of MUSK via its function in RAC1 prenylation and activation.6 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"Mutational analysis of alpha-subunit of protein farnesyltransferase. Evidence for a catalytic role."_x005F_x005F_x000D_Andres D.A., Goldstein J.L., Ho Y.K., Brown M.S._x005F_x005F_x000D_J. Biol. Chem. 268:1383-1390(1993) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), MUTAGENESIS OF LYS-164, FUNCTION, CATALYTIC ACTIVITY, SUBUNIT.Ref.3"Characterization of recombinant human farnesyl-protein transferase: cloning, expression, farnesyl diphosphate binding, and functional homology with yeast prenyl-protein transferases."_x005F_x005F_x000D_Omer C.A., Kral A.M., Diehl R.E., Prendergast G.C., Powers S., Allen C.M., Gibbs J.B., Kohl N.E._x005F_x005F_x000D_Biochemistry 32:5167-5176(1993) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), MUTAGENESIS OF ASN-199, CATALYTIC ACTIVITY, FUNCTION.Ref.16"3-aminopyrrolidinone farnesyltransferase inhibitors: design of macrocyclic compounds with improved pharmacokinetics and excellent cell potency."_x005F_x005F_x000D_Bell I.M., Gallicchio S.N., Abrams M., Beese L.S., Beshore D.C., Bhimnathwala H., Bogusky M.J., Buser C.A., Culberson J.C., Davide J., Ellis-Hutchings M., Fernandes C., Gibbs J.B., Graham S.L., Hamilton K.A., Hartman G.D., Heimbrook D.C., Homnick C.F. , Huber H.E., Huff J.R., Kassahun K., Koblan K.S., Kohl N.E., Lobell R.B., Lynch J.J. Jr., Robinson R., Rodrigues A.D., Taylor J.S., Walsh E.S., Williams T.M., Zartman C.B._x005F_x005F_x000D_J. Med. Chem. 45:2388-2409(2002) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.0 ANGSTROMS) IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY.Ref.17"Dual protein farnesyltransferase-geranylgeranyltransferase-I inhibitors as potential cancer chemotherapeutic agents."_x005F_x005F_x000D_deSolms S.J., Ciccarone T.M., MacTough S.C., Shaw A.W., Buser C.A., Ellis-Hutchings M., Fernandes C., Hamilton K.A., Huber H.E., Kohl N.E., Lobell R.B., Robinson R.G., Tsou N.N., Walsh E.S., Graham S.L., Beese L.S., Taylor J.S._x005F_x005F_x000D_J. Med. Chem. 46:2973-2984(2003) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.0 ANGSTROMS) IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY.Ref.20"Conversion of protein farnesyltransferase to a geranylgeranyltransferase."_x005F_x005F_x000D_Terry K.L., Casey P.J., Beese L.S._x005F_x005F_x000D_Biochemistry 45:9746-9755(2006) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.50 ANGSTROMS) IN COMPLEX WITH FNTB, FUNCTION, SUBUNIT, CATALYTIC ACTIVITY.Ref.21"Structural basis for binding and selectivity of antimalarial and anticancer ethylenediamine inhibitors to protein farnesyltransferase."_x005F_x005F_x000D_Hast M.A., Fletcher S., Cummings C.G., Pusateri E.E., Blaskovich M.A., Rivas K., Gelb M.H., Van Voorhis W.C., Sebti S.M., Hamilton A.D., Beese L.S._x005F_x005F_x000D_Chem. Biol. 16:181-192(2009) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (1.80 ANGSTROMS) OF 1-379 IN COMPLEX WITH FNTB, SUBUNIT, FUNCTION, CATALYTIC ACTIVITY. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.56 ng/mL

Bovine FNTA ELISA KIT
ELI-07852b	Lifescience Market	96 Tests	EUR 928

Mouse Fnta ELISA KIT
ELI-07853m	Lifescience Market	96 Tests	EUR 865

Human Farnesyltransferase Beta (FNTb) ELISA Kit
20-abx258623	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Farnesyltransferase Beta(FNTb)ELISA Kit
QY-E03677	Qayee Biotechnology	96T	EUR 361

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
SEJ090Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Farnesyltransferase Beta (FNTb) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<1 Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Farnesyltransferase Beta (FNTb) in Tissue homogenates, cell lysates and other biological fluids.

Human Farnesyltransferase Beta (FNTb) ELISA Kit
4-SEJ090Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Farnesyltransferase Beta elisa. Alternative names of the recognized antigen: FPTB CAAX farnesyltransferase subunit beta Ras proteins prenyltransferase subunit beta
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Farnesyltransferase Beta (FNTb) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Recombinant human FNTA
P1431	FN Test	100ug	Ask for price
Uniprot ID: P49354 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human FNTA

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E01F0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E01F0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E01F0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human FNTb (Farnesyltransferase Beta)
ELK5384	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Farnesyltransferase Beta (FNTb). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fa Show more
Description: A sandwich ELISA kit for detection of Farnesyltransferase Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

FNTA siRNA
20-abx901995	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FNTA Antibody
20-abx241221	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

FNTA siRNA
20-abx917055	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FNTA siRNA
20-abx917056	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

FNTA antibody
70R-2956	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal FNTA antibody raised against the N terminal of FNTA

FNTA Antibody
ABD8125	Lifescience Market	100 ug	EUR 438

FNTA Antibody
36174-100ul	SAB	100ul	EUR 252

FNTA antibody
70R-17339	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal FNTA antibody

FNTA antibody
70R-1202	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal FNTA antibody raised against the C terminal of FNTA

FNTA Antibody
DF8125	Affbiotech	200ul	EUR 304
Description: FNTA Antibody detects endogenous levels of total FNTA.

FNTA Antibody
1-CSB-PA008777GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FNTA. Recognizes FNTA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FNTA Antibody
1-CSB-PA064938	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FNTA. Recognizes FNTA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

anti-FNTA
YF-PA11835	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to FNTA

anti-FNTA
YF-PA11836	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to FNTA

anti-FNTA
YF-PA11837	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to FNTA

Human FNTA shRNA Plasmid
20-abx951638	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FNTA Recombinant Protein (Human)
RP012424	ABM	100 ug	Ask for price

FNTA Recombinant Protein (Human)
RP039253	ABM	100 ug	Ask for price

Human fFDFT1(Farnesyl Diphosphate Farnesyltransferase 1) ELISA Kit
EH3056	FN Test	96T	EUR 524.1
Detection range: 1.563-100mIU/ml Alias: fFDFT1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938mU/ml

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit
GA-E0768HM-48T	GenAsia Biotech	48T	EUR 289

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit
GA-E0768HM-96T	GenAsia Biotech	96T	EUR 466

Human Protein farnesyltransferase subunit beta, FNTB ELISA KIT
ELI-32519h	Lifescience Market	96 Tests	EUR 824

Human Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx252452-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human farnesyl-diphosphate farnesyltransferase 1,FDFT1 ELISA Kit
201-12-0752	SunredBio	96 tests	EUR 440
This farnesyl-diphosphate farnesyltransferase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human farnesyl-diphosphate farnesyltransferase 1(FDFT1)ELISA Kit
QY-E03679	Qayee Biotechnology	96T	EUR 361

Human Farnesyltransferase Beta (FNTb) CLIA Kit
20-abx495613	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E06F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E06F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E06F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E02F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E02F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E02F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E03F0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E03F0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E03F0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E04F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E04F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E04F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E08F0214-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E08F0214-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E08F0214-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E09F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E09F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E09F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E07F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E07F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E07F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

FNTA Conjugated Antibody
C36174	SAB	100ul	EUR 397

FNTA cloning plasmid
CSB-CL008777HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 645 Sequence: atgtcctgtacagttagagatgtttatgattacttccgagctgtcctgcagcgtgatgaaagaagtgaacgagcttttaagctaacccgggatgctattgagttaaatgcagccaattatacagtgtggcatttccggagagttcttttgaagtcacttcagaaggatctacatga Show more
Description: A cloning plasmid for the FNTA gene.

FNTA cloning plasmid
CSB-CL008777HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1140 Sequence: ATGGCGGCCACCGAGGGGGTCGGGGAGGCTGCGCAAGGGGGCGAGCCCGGGCAGCCGGCGCAACCCCCGCCCCAGCCGCACCCACCGCCGCCCCAGCAGCAGCACAAGGAAGAGATGGCGGCCGAGGCTGGGGAAGCCGTGGCGTCCCCCATGGACGACGGGTTTGTGAGCCTGG Show more
Description: A cloning plasmid for the FNTA gene.

anti- FNTA antibody
FNab03180	FN Test	100µg	EUR 548.75
Immunogen: farnesyltransferase, CAAX box, alpha Uniprot ID: P49354 Gene ID: 2339 Research Area: Metabolism
Description: Antibody raised against FNTA

FNTA Rabbit pAb
A8805-100ul	Abclonal	100 ul	EUR 308

FNTA Rabbit pAb
A8805-200ul	Abclonal	200 ul	EUR 459

FNTA Rabbit pAb
A8805-20ul	Abclonal	20 ul	EUR 183

FNTA Rabbit pAb
A8805-50ul	Abclonal	50 ul	EUR 223

FNTA Blocking Peptide
33R-5613	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FNTA antibody, catalog no. 70R-2956

FNTA Blocking Peptide
33R-2083	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FNTA antibody, catalog no. 70R-1202

FNTA Blocking Peptide
DF8125-BP	Affbiotech	1mg	EUR 195

Anti-FNTA antibody
PAab03180	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-FNTA
PVT13509	Lifescience Market	2 ug	EUR 391

Anti-FNTA antibody
STJ111424	St John's Laboratory	100 µl	EUR 277
Description: Prenyltransferases can attach either a farnesyl group or a geranylgeranyl group in thioether linkage to the cysteine residue of proteins with a C-terminal CAAX box. CAAX geranylgeranyltransferase and CAAX farnesyltransferase are heterodimers that share the same alpha subunit but have different beta subunits. This gene encodes the alpha subunit of these transferases. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 11 and 13.

ELISA kit for Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1)
E-EL-H1250	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's FDFT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human FDFT1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1) in samples from Serum, Plasma, Cell supernatant

FNTA ORF Vector (Human) (pORF)
ORF004142	ABM	1.0 ug DNA	EUR 95

FNTA ORF Vector (Human) (pORF)
ORF013085	ABM	1.0 ug DNA	EUR 354

Human TNF-alpha ELISA Kit, 96 tests, Quantitative
100-215-TNH	Alpha Diagnostics	1 kit	EUR 482

Monkey Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx359694-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx361477-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx362487-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E05F0213-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E05F0213-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 ELISA kit
E05F0213-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein farnesyltransferase subunit beta, Fntb ELISA KIT
ELI-12899m	Lifescience Market	96 Tests	EUR 865

Bovine Protein farnesyltransferase subunit beta, FNTB ELISA KIT
ELI-30850b	Lifescience Market	96 Tests	EUR 928

Sheep Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx364435-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Chicken Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx356427-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Alpha Fetoprotein (AFP) ELISA Kit, 96 tests, Quantitative
500	Alpha Diagnostics	1 kit	EUR 469

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human farnesyl- diphosphate farnesyltransferase 1, FDFT1 ELISA K
ELA-E1708h	Lifescience Market	96 Tests	EUR 824

Polyclonal FNTA Antibody (Center)
APR05040G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FNTA (Center). This antibody is tested and proven to work in the following applications:

Rat FNTA shRNA Plasmid
20-abx984921	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse FNTA shRNA Plasmid
20-abx970381	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

FNTA Recombinant Protein (Rat)
RP201626	ABM	100 ug	Ask for price

FNTA Recombinant Protein (Mouse)
RP134963	ABM	100 ug	Ask for price

Human Farnesyl Diphosphate Farnesyltransferase 1 (fFDFT1) CLIA Kit
abx196646-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Farnesyltransferase Beta (FNTB) Antibody
20-abx124317	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
20-abx112467	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
20-abx007515	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
abx031594-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
abx031594-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
abx029024-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
abx029024-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
20-abx327827	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
20-abx302622	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody
abx233181-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

FNTA sgRNA CRISPR Lentivector set (Human)
K0792801	ABM	3 x 1.0 ug	EUR 339

Mouse alpha 2-Macroglobulin (A2M) ELISA kit
600-720-A2M	Alpha Diagnostics	1 Kit	EUR 773

Human Anti-Alpha Fodrin IgG ELISA kit, 96 tests, Quantitative
3300-160-AFG	Alpha Diagnostics	1 kit	EUR 590

Human hypoxia-inducible transcription factor 1 alpha (HIF-1 alpha) ELISA Kit, 96 tests, Quantitative
100-530-HIF	Alpha Diagnostics	1 Kit	EUR 712

Guinea pig Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) ELISA Kit
abx357305-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Recombinant (E.Coli) Human p38 alpha/SAPK2 alpha
RP-675	Alpha Diagnostics	1 ug	EUR 286

CLIA kit for Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1)
E-CL-H0810	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's FDFT1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human FDFT1 . Standards or samples are added to the micro CLIA plate wells and combined with th Show more
Description: A sandwich CLIA kit for quantitative measurement of Human FDFT1 (Farnesyl Diphosphate Farnesyltransferase 1) in samples from Serum, Plasma, Cell supernatant

Mouse TNF-alpha ELISA Kit, 96 tests, Quantitative
100-210-TNF	Alpha Diagnostics	1 kit	EUR 482

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Polyclonal FNTA Antibody (C-term)
APR14336G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FNTA (C-term). This antibody is tested and proven to work in the following applications:

Fnta ORF Vector (Rat) (pORF)
ORF067210	ABM	1.0 ug DNA	EUR 506

Fnta ORF Vector (Mouse) (pORF)
ORF044989	ABM	1.0 ug DNA	EUR 506

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

FNTA sgRNA CRISPR Lentivector (Human) (Target 1)
K0792802	ABM	1.0 ug DNA	EUR 154

FNTA sgRNA CRISPR Lentivector (Human) (Target 2)
K0792803	ABM	1.0 ug DNA	EUR 154

FNTA sgRNA CRISPR Lentivector (Human) (Target 3)
K0792804	ABM	1.0 ug DNA	EUR 154

FNTA Protein Vector (Human) (pPB-C-His)
PV052337	ABM	500 ng	EUR 481

FNTA Protein Vector (Human) (pPB-N-His)
PV052338	ABM	500 ng	EUR 481

FNTA Protein Vector (Human) (pPM-C-HA)
PV052339	ABM	500 ng	EUR 481

FNTA Protein Vector (Human) (pPM-C-His)
PV052340	ABM	500 ng	EUR 481

FNTA Protein Vector (Human) (pPB-C-His)
PV016565	ABM	500 ng	EUR 329

FNTA Protein Vector (Human) (pPB-N-His)
PV016566	ABM	500 ng	EUR 329

FNTA Protein Vector (Human) (pPM-C-HA)
PV016567	ABM	500 ng	EUR 329

FNTA Protein Vector (Human) (pPM-C-His)
PV016568	ABM	500 ng	EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Farnesyl-Diphosphate Farnesyltransferase 1 (Recombinant)
20-abx073856	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody (HRP)
20-abx303881	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody (FITC)
20-abx303882	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Farnesyltransferase Beta (FNTB) Antibody (Biotin)
20-abx303883	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human Farnesyl Diphosphate Farnesyltransferase 1 (FDFT1) Protein
20-abx066494	Abbexa	EUR 676.00 EUR 272.00 EUR 2054.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Human Fodrin-alpha (spectrin-alpha) control/blocking peptide
FOD11-P	Alpha Diagnostics	100 ug	EUR 164

Rabbit Anti-Human Fodrin-alpha (spectrin-alpha) antiserum
FOD11-S	Alpha Diagnostics	100 ul	EUR 457

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

Human 17 alpha Hydroxyprogesterone (17-OHP/17OHP) ELISA Kit, 96 tests, Quantitative
1870	Alpha Diagnostics	1 kit	EUR 529

Human Zeta (z) Globin (alpha thalassemia ) ELISA Kit, 96 tests, Semi-Quantitative
1970	Alpha Diagnostics	1 kit	EUR 651

Recombinant Human Alpha-Synuclein
RP-847	Alpha Diagnostics	20 ug	EUR 164

Monkey Interferon-alpha (IFN-?) ELISA Kit, 96 tests, Quantitative
9745	Alpha Diagnostics	1 Kit	EUR 773

Pig Alpha Fetoprotein (?FP) ELISA Kit, 96 tests, Quantitative
9930	Alpha Diagnostics	1 Kit	EUR 773

Pig Interferon alpha (IFN-?) ELISA Kit, 96 tests, Quantitative
9945	Alpha Diagnostics	1 Kit	EUR 773

Chicken Interferon alpha (IFN-?) ELISA Kit, 96 tests, Quantitative
10680	Alpha Diagnostics	1 Kit	EUR 773

Mouse IL-1 alpha ELISA Kit, 96 tests, Quantitative
MIL-01A-145	Alpha Diagnostics	1 kit	EUR 482

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Rabbit Anti-Human Glutathione Transferase alpha (GST-alpha) antiserum
GSTA12-S	Alpha Diagnostics	100 ul	EUR 457

human Topoisomerase II alpha (TOP2 alpha) Control/blocking peptide
TOP2A11-P	Alpha Diagnostics	100 ug	EUR 164

Human IL-2 receptor alpha, soluble (IL2RsA/CD25) ELISA Kit, 96 tests, quantitative
210-340-I2R	Alpha Diagnostics	1 Kit	EUR 773

Human Alpha-Thrombin (human plasma), purified
TBNA16-N-100	Alpha Diagnostics	100 ug	EUR 164

Mouse Alpha defensin 1 (DEFa1) ELISA Kit, 96 tests, Quantitative
9205	Alpha Diagnostics	1 Kit	EUR 895

Mouse Estrogen Receptor Alpha (ER?) ELISA Kit, 96 tests, Quantitative
9265	Alpha Diagnostics	1 Kit	EUR 773

Guinea pig Interferon-alpha (IFN-?) ELISA Kit, 96 tests, Quantitative
9880	Alpha Diagnostics	1 Kit	EUR 773

Horse Interleukin 1 alpha (IL1a) ELISA Kit, 96 tests, Quantitative
10515	Alpha Diagnostics	1 Kit	EUR 773

Rat TNF-alpha ELISA Kit, High Sensitivity, 96 tests, Quantitative
100-205-TNR	Alpha Diagnostics	1 kit	EUR 482

Rat alpha 2-Macroglobulin (A2M) ELISA kit 96 tests, Quantitative
610-420-A2M	Alpha Diagnostics	1 Kit	EUR 773