Human KLK13(Kallikrein 13) ELISA Kit

Human KLK13(Kallikrein 13) ELISA Kit

To Order Contact us: 

    Human Kallikrein 13 (KLK13) ELISA Kit

    RDR-KLK13-Hu-48Tests 48 Tests
    EUR 544

    Human Kallikrein 13 (KLK13) ELISA Kit

    RDR-KLK13-Hu-96Tests 96 Tests
    EUR 756

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    DLR-KLK13-Mu-48T 48T
    EUR 527
    • Should the Mouse Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    DLR-KLK13-Mu-96T 96T
    EUR 688
    • Should the Mouse Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    RD-KLK13-Mu-48Tests 48 Tests
    EUR 533

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    RD-KLK13-Mu-96Tests 96 Tests
    EUR 740

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    RDR-KLK13-Mu-48Tests 48 Tests
    EUR 557

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    RDR-KLK13-Mu-96Tests 96 Tests
    EUR 774

    Human Kallikrein- 13, KLK13 ELISA KIT

    ELI-43303h 96 Tests
    EUR 824

    Human Kallikrein 13 (KLK13) ELISA Kit

    20-abx152086
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Kallikrein 13(KLK13)ELISA Kit

    QY-E02952 96T
    EUR 361

    Human Kallikrein 13 (KLK13) ELISA Kit

    SED373Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Kallikrein 13 (KLK13) ELISA Kit

    SED373Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Kallikrein 13 (KLK13) ELISA Kit

    SED373Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Kallikrein 13 (KLK13) ELISA Kit

    SED373Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Kallikrein 13 (KLK13) ELISA Kit

    4-SED373Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
    • KLKL4
    • Kallikrein-like protein 4
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Kallikrein 13 (KLK13) Antibody

    20-abx129211
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Kallikrein 13 (KLK13) Antibody

    20-abx129912
    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Kallikrein 13 (KLK13) Antibody

    20-abx173224
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Kallikrein 13 (KLK13) Antibody

    20-abx177245
    • EUR 1233.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Kallikrein 13 (KLK13) Antibody

    20-abx177246
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Kallikrein 13 (KLK13) Antibody

    20-abx339236
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Kallikrein 13 (KLK13) Antibody

    20-abx210856
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Recombinant Kallikrein 13 (KLK13)

    4-RPD373Hu01
    • EUR 494.24
    • EUR 235.00
    • EUR 1578.40
    • EUR 592.80
    • EUR 1085.60
    • EUR 394.00
    • EUR 3796.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9UKR3
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 32.2kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Kallikrein 13 expressed in: E.coli

    Recombinant Kallikrein 13 (KLK13)

    4-RPD373Mu01
    • EUR 512.16
    • EUR 240.00
    • EUR 1645.60
    • EUR 615.20
    • EUR 1130.40
    • EUR 406.00
    • EUR 3964.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P36368
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 29.8kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Mouse Kallikrein 13 expressed in: E.coli

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    20-abx154281
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    SED373Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4862.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    SED373Mu-1x48wellstestplate 1x48-wells test plate
    EUR 488.08
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    SED373Mu-1x96wellstestplate 1x96-wells test plate
    EUR 654.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    SED373Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2644.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Mouse Kallikrein 13 (KLK13) ELISA Kit

    4-SED373Mu
    • EUR 4913.00
    • EUR 2595.00
    • EUR 655.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4
    • KLKL4
    • Kallikrein-like protein 4
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Kallikrein 13 (KLK13) Protein

    20-abx167044
    • EUR 690.00
    • EUR 286.00
    • EUR 2124.00
    • EUR 815.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Kallikrein 13 (KLK13) CLIA Kit

    20-abx494238
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human KLK13 (Kallikrein 13)

    ELK4917 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
    • Show more
    Description: A sandwich ELISA kit for detection of Kallikrein 13 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Kallikrein-13 (KLK13)

    KTE61899-48T 48T
    EUR 332
    • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Kallikrein-13 (KLK13)

    KTE61899-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Kallikrein-13 (KLK13)

    KTE61899-96T 96T
    EUR 539
    • Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse KLK13 (Kallikrein 13)

    ELK7224 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1
    • Show more
    Description: A sandwich ELISA kit for detection of Kallikrein 13 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Mouse Kallikrein 13 (KLK13) CLIA Kit

    20-abx494239
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Kallikrein 13 (KLK13) polyclonal antibody

    ABP-PAB-10239 100 ug Ask for price
      • Product line: Miscellaneous
      • Brand:

    Mouse Kallikrein 13 (KLK13) Protein

    20-abx168449
    • EUR 718.00
    • EUR 286.00
    • EUR 2221.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    OVA conjugated Kallikrein 13 (KLK13)

    4-CPD373Hu21
    • EUR 413.60
    • EUR 214.00
    • EUR 1276.00
    • EUR 492.00
    • EUR 884.00
    • EUR 340.00
    • EUR 3040.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9UKR3
    • Buffer composition: PBS, pH 7.4.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): Inquire
    • Isoelectric Point: Inquire
    Description: Recombinant Human Kallikrein 13 expressed in: chemical synthesis

    KLK13 Kallikrein-13 Human Recombinant Protein

    PROTQ9UKR3 Regular: 5ug
    EUR 317
    Description: KLK13 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 284 amino acids (17-277 a.a) and having a molecular mass of 31.3kDa.;KLK13 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human)

    4-PAD373Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Glu22~Gln277)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13)

    Recombinant Human Kallikrein 13/KLK13 (C-6His)

    C362-10ug 10ug
    EUR 202
    Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

    Recombinant Human Kallikrein 13/KLK13 (C-6His)

    C362-1mg 1mg
    EUR 2283
    Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

    Recombinant Human Kallikrein 13/KLK13 (C-6His)

    C362-500ug 500ug
    EUR 1613
    Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

    Recombinant Human Kallikrein 13/KLK13 (C-6His)

    C362-50ug 50ug
    EUR 496
    Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC

    4-PAD373Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Glu22~Gln277)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Biotinylated

    4-PAD373Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Glu22~Gln277)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Biotin.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Cy3

    4-PAD373Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Glu22~Gln277)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Cy3.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human), FITC

    4-PAD373Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Glu22~Gln277)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with FITC.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human), HRP

    4-PAD373Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Glu22~Gln277)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with HRP.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human), PE

    4-PAD373Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Glu22~Gln277)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with PE.

    KLK13 Human, Kallikrein-13 Human Recombinant Protein, sf9

    PROTQ9UKR3-1 Regular: 5ug
    EUR 317
    Description: KLK13 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 267 amino acids (17-277a.a.) and having a molecular mass of 29.7kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40kDa). KLK13 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

    Polyclonal KLK13 / Kallikrein 13 Antibody (aa262-277)

    APR02667G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KLK13 / Kallikrein 13 (aa262-277). This antibody is tested and proven to work in the following applications:

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC-Cy7

    4-PAD373Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Glu22~Gln277)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat)

    4-PAD373Mu01
    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Val25~Ala261)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13)

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC

    4-PAD373Mu01-APC
    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Val25~Ala261)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

    4-PAD373Mu01-Biotin
    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Val25~Ala261)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Biotin.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Cy3

    4-PAD373Mu01-Cy3
    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Val25~Ala261)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Cy3.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), FITC

    4-PAD373Mu01-FITC
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Val25~Ala261)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with FITC.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), HRP

    4-PAD373Mu01-HRP
    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Val25~Ala261)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with HRP.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), PE

    4-PAD373Mu01-PE
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Val25~Ala261)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with PE.

    Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

    4-PAD373Mu01-APC-Cy7
    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: KLK13 (Val25~Ala261)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7.

    99445-13 DCT 13 X 100MM

    99445-13 250/pk
    EUR 76
    Description: Disposable Culture Tubes; DCT's, CGW

    anti-Kallikrein 13

    YF-PA18203 50 ul
    EUR 363
    Description: Mouse polyclonal to Kallikrein 13

    99999 CAP 13-415

    99999-13 1000/pk
    EUR 219
    Description: Disposable Screw Cap Culture Tubes; DSCCT's, Caps

    Kallikrein 13 Protein (OVA)

    20-abx165562
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Anti-Kallikrein 13 (1G9)

    YF-MA18049 100 ug
    EUR 363
    Description: Mouse monoclonal to Kallikrein 13

    9998 SCREW CAP 415/13

    9998-13 288/pk
    EUR 198
    Description: General Apparatus; Stoppers

    Human CellExp? Kallikrein-13, human recombinant

    7413-10
    EUR 278

    ELISA kit for Human KLK13

    EK5504 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human KLK13 in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human KLK13 PicoKine ELISA Kit

    EK1168 96 wells
    EUR 425
    Description: For quantitative detection of human KLK13 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

    KLK13 ELISA Kit (Human) (OKCD00765)

    OKCD00765 96 Wells
    EUR 831
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.6 pg/mL

    KLK13 ELISA Kit (Human) (OKBB00909)

    OKBB00909 96 Wells
    EUR 505
    Description: Description of target: Kallikrein-13 is a protein that in humans is encoded by the KLK13 gene. It belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. By genomic sequence analysis, KLK13 gene is mapped in a 300-kb region on chromosome 19q13.3-q13.4. It has been shown that recombinant hK13 produced in yeast can cleave synthetic peptides after the arginine residue and some extracellular matrix components. However, its exact physiological substrates and functions remain obscure. Despite the lack of knowledge on the physiological function of hK13, several studies have demonstrated that hK13 is implicated with cancer of the breast and ovary and it can serve as a favorable prognostic biomarker for these malignancies.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

    99447 DSSCT 13 X 100MM W/ MARING SPOT

    99447-13 250/pk
    EUR 332
    Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

    99449 DSSCT 13 X 100MM W/O MARKING SPOT

    99449-13 250/pk
    EUR 281
    Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    CA199 (Cancer antigen) ELISA test

    13 96T/Box Ask for price
    • Area of application: Hormone testing
    Description: ELISA based test for quantitative detection of CA199 (Cancer antigen)

    KLK13 siRNA

    20-abx921819
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    KLK13 protein

    80R-4293 20 ug
    EUR 327
    Description: Purified Recombinant KLK13 protein (His tagged)

    KLK13 antibody

    70R-3265 50 ug
    EUR 467
    Description: Rabbit polyclonal KLK13 antibody raised against the middle region of KLK13

    KLK13 Antibody

    36578-100ul 100ul
    EUR 252

    KLK13 Antibody

    1-CSB-PA374084
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

    KLK13 Antibody

    1-CSB-PA185718
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

    Human KalliKrein 1 ELISA kit

    E01K0026-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human KalliKrein 1 ELISA kit

    E01K0026-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human KalliKrein 1 ELISA kit

    E01K0026-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 10 ELISA kit

    E01K0070-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 10 ELISA kit

    E01K0070-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 10 ELISA kit

    E01K0070-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 11 ELISA kit

    E01K0072-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 11 ELISA kit

    E01K0072-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 11 ELISA kit

    E01K0072-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 6 ELISA kit

    E01K0073-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 6 ELISA kit

    E01K0073-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 6 ELISA kit

    E01K0073-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 7 ELISA kit

    E01K0074-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 7 ELISA kit

    E01K0074-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 7 ELISA kit

    E01K0074-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 8 ELISA kit

    E01K0075-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 8 ELISA kit

    E01K0075-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 8 ELISA kit

    E01K0075-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 2 ELISA kit

    E01K0077-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 2 ELISA kit

    E01K0077-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 2 ELISA kit

    E01K0077-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 3 ELISA kit

    E01K0078-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 3 ELISA kit

    E01K0078-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 3 ELISA kit

    E01K0078-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 5 ELISA kit

    E01K0079-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 5 ELISA kit

    E01K0079-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 5 ELISA kit

    E01K0079-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Kallikrein 2 ELISA Kit

    ELA-E0278h 96 Tests
    EUR 824

    Human Kallikrein 9 ELISA Kit

    ELA-E0408h 96 Tests
    EUR 824

    Human Kallikrein 11 ELISA Kit

    ELA-E0669h 96 Tests
    EUR 824

    Human Kallikrein 8 ELISA Kit

    ELA-E0690h 96 Tests
    EUR 824

    Human Kallikrein 6 ELISA Kit

    ELA-E0691h 96 Tests
    EUR 824

    Human Kallikrein 10 ELISA Kit

    ELA-E0697h 96 Tests
    EUR 824

    Human Kallikrein 1 ELISA Kit

    ELA-E0967h 96 Tests
    EUR 824

    Human Kallikrein 7 ELISA Kit

    ELA-E1910h 96 Tests
    EUR 824

    Human Kallikrein 3 ELISA Kit

    ELA-E8720h 96 Tests
    EUR 824

    Human Kallikrein 6 ELISA Kit

    ELA-E8916h 96 Tests
    EUR 824

    Kallikrein 11 ELISA KIT|Human

    EF010428 96 Tests
    EUR 689

    Human Kallikrein 3 ELISA Kit

    55R-1761 1 kit
    EUR 651
    Description: ELISA kit for detection of Kallikrein 3 in the research laboratory

    Human Kallikrein-6 ELISA Kit

    LF-EK50923 1×96T
    EUR 648

    Human Kallikrein 14 ELISA Kit

    LF-EK50970 1×96T
    EUR 648

    Human KLK13 shRNA Plasmid

    20-abx958699
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    KLK13 Recombinant Protein (Human)

    RP017230 100 ug Ask for price

    Human IL-13(Interleukin 13) ELISA Kit

    EH3266 96T
    EUR 476.25
    • Detection range: 15.625-1000 pg/ml
    • Uniprot ID: P35225
    • Alias: IL-13(Interleukin 13)/BHR1interleukin-13
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

    Human cytokeratin 13(CK-13)ELISA Kit

    GA-E1624HM-48T 48T
    EUR 289

    Human cytokeratin 13(CK-13)ELISA Kit

    GA-E1624HM-96T 96T
    EUR 466

    Human Interleukin 13(IL-13)ELISA Kit

    GA-E0138HM-48T 48T
    EUR 289

    Human Interleukin 13(IL-13)ELISA Kit

    GA-E0138HM-96T 96T
    EUR 466

    Human Interleukin 13,IL-13 ELISA KIT

    201-12-0099 96 tests
    EUR 440
    • This Interleukin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human cytokeratin 13,CK-13 ELISA Kit

    201-12-1608 96 tests
    EUR 440
    • This cytokeratin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Interleukin 13, IL-13 ELISA KIT

    CSB-E04601h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Interleukin 13, IL-13 ELISA KIT

    1-CSB-E04601h
    • EUR 603.00
    • EUR 4247.00
    • EUR 2260.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Interleukin 13,IL-13 ELISA KIT

    CN-03217H1 96T
    EUR 434

    Human Interleukin 13,IL-13 ELISA KIT

    CN-03217H2 48T
    EUR 284

    Human Interleukin-13 (IL-13) ELISA Kit

    LF-EK60050 1×96T
    EUR 790

    Human Interleukin 13(IL-13)ELISA Kit

    QY-E04326 96T
    EUR 361

    Human cytokeratin 13(CK-13)ELISA Kit

    QY-E00980 96T
    EUR 361

    Human ADAMTS -13(ADAMTS -13) ELISA Kit

    QY-E05516 96T
    EUR 361

    KLK13 Conjugated Antibody

    C36578 100ul
    EUR 397

    KLK13 Polyclonal Antibody

    ES11092-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against KLK13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    KLK13 Polyclonal Antibody

    ES11092-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against KLK13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    KLK13 Polyclonal Antibody

    ABP59062-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

    KLK13 Polyclonal Antibody

    ABP59062-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

    KLK13 Polyclonal Antibody

    ABP59062-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human KLK13 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

    KLK13 Rabbit pAb

    A14274-100ul 100 ul
    EUR 308

    KLK13 Rabbit pAb

    A14274-200ul 200 ul
    EUR 459

    KLK13 Rabbit pAb

    A14274-20ul 20 ul
    EUR 183

    KLK13 Rabbit pAb

    A14274-50ul 50 ul
    EUR 223

    KLK13 Blocking Peptide

    33R-9689 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK13 antibody, catalog no. 70R-3265

    KLK13 cloning plasmid

    CSB-CL891952HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 834
    • Sequence: atgtggcccctggccctagtgatcgcctccctgaccttggccttgtcaggaggtgtctcccaggagtcttccaaggttctcaacaccaatgggaccagtgggtttctcccaggtggctacacctgcttcccccactctcagccctggcaggctgccctactagtgcaagggcggct
    • Show more
    Description: A cloning plasmid for the KLK13 gene.

    Anti-KLK13 antibody

    STJ116486 100 µl
    EUR 277
    Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has been identified, but its full length sequence has not been determined.

    Anti-KLK13 antibody

    STJ192250 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to KLK13

    Human CK-13/KRT13(Cytokeratin 13) ELISA Kit

    EH2818 96T
    EUR 524.1
    • Detection range: 15.625-1000 pg/ml
    • Uniprot ID: P13646
    • Alias: CK-13/KRT13/Cytokeratin-13/CK-13/Keratin-13/K13/Keratin, type I cytoskeletal 13
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

    Human Matrix metalloproteinase 13(MMP-13)ELISA Kit

    GA-E0928HM-48T 48T
    EUR 289

    Human Matrix metalloproteinase 13(MMP-13)ELISA Kit

    GA-E0928HM-96T 96T
    EUR 466

    Human Matrix metalloproteinase 13,MMP-13 ELISA kit

    201-12-0912 96 tests
    EUR 440
    • This Matrix metalloproteinase 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Matrix metalloproteinase 13, MMP-13 ELISA kit

    CSB-E04674h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase 13, MMP-13 in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Matrix metalloproteinase 13, MMP-13 ELISA kit

    1-CSB-E04674h
    • EUR 723.00
    • EUR 4883.00
    • EUR 2591.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase 13, MMP-13 in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Matrix metalloproteinase 13,MMP-13 ELISA kit

    CN-03225H1 96T
    EUR 448

    Human Matrix metalloproteinase 13,MMP-13 ELISA kit

    CN-03225H2 48T
    EUR 297

    ELISA kit for Human IL-13 (Interleukin 13)

    E-EL-H0104 1 plate of 96 wells
    EUR 534
    • Gentaur's IL-13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-13. Standards or samples are added to the micro ELISA plate wells and combined with
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Human IL-13 (Interleukin 13) in samples from Serum, Plasma, Cell supernatant

    Human Matrix metalloproteinase 13(MMP-13)ELISA Kit

    QY-E02998 96T
    EUR 361

    Human Kallikrein 1 (KLK1) ELISA Kit

    CEA967Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4273.35
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

    Human Kallikrein 1 (KLK1) ELISA Kit

    CEA967Hu-1x48wellstestplate 1x48-wells test plate
    EUR 439.57
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

    Human Kallikrein 1 (KLK1) ELISA Kit

    CEA967Hu-1x96wellstestplate 1x96-wells test plate
    EUR 585.1
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

    Human Kallikrein 1 (KLK1) ELISA Kit

    CEA967Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2332.95
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

    Human Kallikrein 1 (KLK1) ELISA Kit

    4-CEA967Hu
    • EUR 4324.00
    • EUR 2283.00
    • EUR 586.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Kallikrein 1 elisa. Alternative names of the recognized antigen: KLKR
    • Klk6
    • HK1
    • Kallikrein 1, Renal/Pancreas/Salivary
    • Kidney/pancreas/salivary gland kallikrein
    • Tissue kallikrein
    Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 1 (KLK1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Kallikrein 12 (KLK12) ELISA Kit

    CED372Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 12 (KLK12) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 12 (KLK12) in serum, plasma, tissue homogenates and other biological fluids.

    Human Kallikrein 12 (KLK12) ELISA Kit

    CED372Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 12 (KLK12) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 12 (KLK12) in serum, plasma, tissue homogenates and other biological fluids.

    Human Kallikrein 12 (KLK12) ELISA Kit

    CED372Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 12 (KLK12) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 12 (KLK12) in serum, plasma, tissue homogenates and other biological fluids.

    Human Kallikrein 12 (KLK12) ELISA Kit

    CED372Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 12 (KLK12) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 12 (KLK12) in serum, plasma, tissue homogenates and other biological fluids.

    Human Kallikrein 12 (KLK12) ELISA Kit

    4-CED372Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Kallikrein 12 elisa. Alternative names of the recognized antigen: KLK-L5
    • KLKL5
    • Kallikrein-Related Peptidase 12
    • Kallikrein-like protein 5
    Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 12 (KLK12) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Kallikrein 14 (KLK14) ELISA Kit

    CED374Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 14 (KLK14) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 14 (KLK14) in serum, plasma, tissue homogenates and other biological fluids.

    Human Kallikrein 14 (KLK14) ELISA Kit

    CED374Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 14 (KLK14) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 14 (KLK14) in serum, plasma, tissue homogenates and other biological fluids.

    Human Kallikrein 14 (KLK14) ELISA Kit

    CED374Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 14 (KLK14) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 14 (KLK14) in serum, plasma, tissue homogenates and other biological fluids.

    Human Kallikrein 14 (KLK14) ELISA Kit

    CED374Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 14 (KLK14) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 14 (KLK14) in serum, plasma, tissue homogenates and other biological fluids.

    Human Kallikrein 14 (KLK14) ELISA Kit

    4-CED374Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Kallikrein 14 elisa. Alternative names of the recognized antigen: KLK-L6
    • Kallikrein-like protein 6
    Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 14 (KLK14) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Kallikrein 8 (KLK8) ELISA Kit

    CEA690Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4273.35
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 8 (KLK8) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 8 (KLK8) in serum, plasma and other biological fluids.

    Human Kallikrein 8 (KLK8) ELISA Kit

    CEA690Hu-1x48wellstestplate 1x48-wells test plate
    EUR 439.57
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 8 (KLK8) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 8 (KLK8) in serum, plasma and other biological fluids.

    Human Kallikrein 8 (KLK8) ELISA Kit

    CEA690Hu-1x96wellstestplate 1x96-wells test plate
    EUR 585.1
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 8 (KLK8) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 8 (KLK8) in serum, plasma and other biological fluids.

    Human Kallikrein 8 (KLK8) ELISA Kit

    CEA690Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2332.95
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 8 (KLK8) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 8 (KLK8) in serum, plasma and other biological fluids.

    Human Kallikrein 8 (KLK8) ELISA Kit

    4-CEA690Hu
    • EUR 4324.00
    • EUR 2283.00
    • EUR 586.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Kallikrein 8 elisa. Alternative names of the recognized antigen: NP
    • HNP
    • NRPN
    • PRSS19
    • TADG14
    • BSP1
    • Neuropsin
    • Ovasin
    • Brain Serine Protease 1
    • Tumor Associated Differentially Expressed Gene 14
    • Serine protease 19
    Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 8 (KLK8) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Kallikrein 6 (KLK6) ELISA Kit

    CEA691Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4011.55
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 6 (KLK6) in serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk and other biological fluids.

    Human Kallikrein 6 (KLK6) ELISA Kit

    CEA691Hu-1x48wellstestplate 1x48-wells test plate
    EUR 418.01
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 6 (KLK6) in serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk and other biological fluids.

    Human Kallikrein 6 (KLK6) ELISA Kit

    CEA691Hu-1x96wellstestplate 1x96-wells test plate
    EUR 554.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 6 (KLK6) in serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk and other biological fluids.

    Human Kallikrein 6 (KLK6) ELISA Kit

    CEA691Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2194.35
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 6 (KLK6) in serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk and other biological fluids.

    Human Kallikrein 6 (KLK6) ELISA Kit

    4-CEA691Hu
    • EUR 4062.00
    • EUR 2145.00
    • EUR 555.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Kallikrein 6 elisa. Alternative names of the recognized antigen: ZYME
    • Bssp
    • Klk7
    • Neurosin, Zyme
    • PRSS18
    • PRSS9
    • SP59
    • HK6
    • Protease M
    • Serine protease 18
    Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 6 (KLK6) in samples from Serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Kallikrein 10 (KLK10) ELISA Kit

    CEA697Hu-10x96wellstestplate 10x96-wells test plate
    EUR 3160.7
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 10 (KLK10) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 10 (KLK10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Kallikrein 10 (KLK10) ELISA Kit

    CEA697Hu-1x48wellstestplate 1x48-wells test plate
    EUR 347.94
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 10 (KLK10) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 10 (KLK10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Kallikrein 10 (KLK10) ELISA Kit

    CEA697Hu-1x96wellstestplate 1x96-wells test plate
    EUR 454.2
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 10 (KLK10) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 10 (KLK10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Kallikrein 10 (KLK10) ELISA Kit

    CEA697Hu-5x96wellstestplate 5x96-wells test plate
    EUR 1743.9
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 10 (KLK10) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 10 (KLK10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Kallikrein 10 (KLK10) ELISA Kit

    4-CEA697Hu
    • EUR 3211.00
    • EUR 1694.00
    • EUR 455.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Kallikrein 10 elisa. Alternative names of the recognized antigen: NES1
    • PRSSL1
    • Kallikrein-Related Peptidase 10
    • Normal epithelial cell-specific 1
    • Protease serine-like 1
    Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 10 (KLK10) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Kallikrein 11 (KLK11) ELISA Kit

    abx570232-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Kallikrein 9 (KLK9) ELISA Kit

    abx570331-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Kallikrein 7 (KLK7) ELISA Kit

    abx570405-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Kallikrein 2 (KLK2) ELISA Kit

    abx570610-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Kallikrein 6 (KLK6) ELISA Kit

    abx572058-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Kallikrein 4 (KLK4) ELISA Kit

    abx572101-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Human Kallikrein 10 (KLK10) ELISA Kit

    abx574301-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Kallikrein 8 (KLK8) ELISA Kit

    abx575960-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Kallikrein 5 (KLK5) ELISA Kit

    abx576328-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Kallikrein 1 (KLK1) ELISA Kit

    abx576494-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Human plasma kallikrein(KLKB1) ELISA kit

    E01P0813-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human plasma kallikrein(KLKB1) ELISA kit

    E01P0813-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human plasma kallikrein(KLKB1) ELISA kit

    E01P0813-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ELISA kit for Human Kallikrein-8

    EK2128 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-8 in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Kallikrein-6

    EK2130 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-6 in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Kallikrein-10

    EK2137 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-10 in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Kallikrein-1

    EK2486 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Kallikrein-5

    EK2862 96 tests
    EUR 452
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-5 in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Kallikrein-7

    EK4077 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-7 in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Kallikrein 3

    EK5362 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein 3 in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Human Kallikrein 14

    EK5428 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein 14 in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human Kallikrein 3 PicoKine ELISA Kit

    EK0816 96 wells
    EUR 456
    Description: For quantitative detection of Human Kallikrein 3 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

    Human Kallikrein-6 PicoKine ELISA Kit

    EK0818 96 wells
    EUR 425
    Description: For quantitative detection of human Kallikrein-6 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA) .

    Human Kallikrein 14 PicoKine ELISA Kit

    EK0949 96 wells
    EUR 425
    Description: For quantitative detection of human Kallikrein 14 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

    Human KLK1/ Kallikrein-1 ELISA Kit

    E1385Hu 1 Kit
    EUR 571

    Human KLK10/ Kallikrein-10 ELISA Kit

    E1386Hu 1 Kit
    EUR 571

    Human KLK11/ Kallikrein-11 ELISA Kit

    E1387Hu 1 Kit
    EUR 571

    Human KLK2/ Kallikrein-2 ELISA Kit

    E1388Hu 1 Kit
    EUR 571

    Human KLK5/ Kallikrein-5 ELISA Kit

    E1390Hu 1 Kit
    EUR 537

    Human KLK6/ Kallikrein-6 ELISA Kit

    E1391Hu 1 Kit
    EUR 571

    Human KLK7/ Kallikrein-7 ELISA Kit

    E1392Hu 1 Kit
    EUR 571

    Human KLK8/ Kallikrein-8 ELISA Kit

    E1393Hu 1 Kit
    EUR 571

    Human KLK9/ Kallikrein-9 ELISA Kit

    E1394Hu 1 Kit
    EUR 571

    Human KLK6(Kallikrein-6) ELISA Kit

    EH0208 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: Q92876
    • Alias: KLK6/Kallikrein-6/Bssp/PRSS18/PRSS9/SP59/hK6/ZYME
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human KLK1(Kallikrein-1) ELISA Kit

    EH0212 96T
    EUR 567.6
    • Detection range: 0.312-20 ng/ml
    • Uniprot ID: P06870
    • Alias: KLK1/KLK1/Kallikrein-1/Kidney/pancreas/salivary gland kallikrein/Tissue kallikrein
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human KLK5(Kallikrein-5) ELISA Kit

    EH0213 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: Q9Y337
    • Alias: KLK5/Kallikrein-like protein 2(KLK-L2)/Stratum corneum tryptic enzyme
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human KLK2(Kallikrein-2) ELISA Kit

    EH0818 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P20151
    • Alias: KLK2(Kallikrein-2)/Glandular kallikrein-1(hGK-1)/Tissue kallikrein-2
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human KLK8(Kallikrein-8) ELISA Kit

    EH1009 96T
    EUR 524.1
    • Detection range: 0.781-50 ng/ml
    • Uniprot ID: O60259
    • Alias: KLK8(Kallikrein 8)/Neuropsin/Ovasin/PRSS19/hK8/HNP/kallikrein 8(neuropsin/ovasin)/kallikrein-related peptidase 8/KLK8 protein type 1/KLK8 protein type 2/neuropsin type 1/neuropsin type 2/NP/NR
    • Show more
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml