Human KLK13(Kallikrein 13) ELISA Kit

Human KLK13(Kallikrein 13) ELISA Kit

To Order Contact us: 

Human Kallikrein 13 (KLK13) ELISA Kit
RDR-KLK13-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Kallikrein 13 (KLK13) ELISA Kit
RDR-KLK13-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Kallikrein 13 (KLK13) ELISA Kit
DLR-KLK13-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit
DLR-KLK13-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Kallikrein 13 (KLK13) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Kallikrein 13 (KLK13) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit
RD-KLK13-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Kallikrein 13 (KLK13) ELISA Kit
RD-KLK13-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Mouse Kallikrein 13 (KLK13) ELISA Kit
RDR-KLK13-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Kallikrein 13 (KLK13) ELISA Kit
RDR-KLK13-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Kallikrein- 13, KLK13 ELISA KIT
ELI-43303h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 13 (KLK13) ELISA Kit
20-abx152086	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Kallikrein 13(KLK13)ELISA Kit
QY-E02952	Qayee Biotechnology	96T	EUR 361

Human Kallikrein 13 (KLK13) ELISA Kit
SED373Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit
SED373Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit
SED373Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit
SED373Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Kallikrein 13 (KLK13) ELISA Kit
4-SED373Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4 KLKL4 Kallikrein-like protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Kallikrein 13 (KLK13) Antibody
20-abx129211	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody
20-abx129912	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody
20-abx173224	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Kallikrein 13 (KLK13) Antibody
20-abx177245	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Kallikrein 13 (KLK13) Antibody
20-abx177246	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Kallikrein 13 (KLK13) Antibody
20-abx339236	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Kallikrein 13 (KLK13) Antibody
20-abx210856	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Kallikrein 13 (KLK13)
4-RPD373Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UKR3 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.2kDa Isoelectric Point: Inquire
Description: Recombinant Human Kallikrein 13 expressed in: E.coli

Recombinant Kallikrein 13 (KLK13)
4-RPD373Mu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P36368 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.8kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Kallikrein 13 expressed in: E.coli

Mouse Kallikrein 13 (KLK13) ELISA Kit
20-abx154281	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Kallikrein 13 (KLK13) ELISA Kit
SED373Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit
SED373Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit
SED373Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit
SED373Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Kallikrein 13 (KLK13) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Kallikrein 13 (KLK13) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Mouse Kallikrein 13 (KLK13) ELISA Kit
4-SED373Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kallikrein 13 elisa. Alternative names of the recognized antigen: KLK-L4 KLKL4 Kallikrein-like protein 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Kallikrein 13 (KLK13) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Kallikrein 13 (KLK13) Protein
20-abx167044	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Kallikrein 13 (KLK13) CLIA Kit
20-abx494238	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human KLK13 (Kallikrein 13)
ELK4917	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1 Show more
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Kallikrein-13 (KLK13)
KTE61899-48T	Abbkine	48T	EUR 332
Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-13 (KLK13)
KTE61899-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Kallikrein-13 (KLK13)
KTE61899-96T	Abbkine	96T	EUR 539
Kallikrein-13 is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has bee Show more
Description: Quantitative sandwich ELISA for measuring Human Kallikrein-13 (KLK13) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse KLK13 (Kallikrein 13)
ELK7224	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Kallikrein 13 (KLK13). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Kallikrein 1 Show more
Description: A sandwich ELISA kit for detection of Kallikrein 13 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Kallikrein 13 (KLK13) CLIA Kit
20-abx494239	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Kallikrein 13 (KLK13) polyclonal antibody
ABP-PAB-10239	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

Mouse Kallikrein 13 (KLK13) Protein
20-abx168449	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

OVA conjugated Kallikrein 13 (KLK13)
4-CPD373Hu21	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9UKR3 Buffer composition: PBS, pH 7.4. Form: Freeze-dried powder Predicted Molecular Mass (KD): Inquire Isoelectric Point: Inquire
Description: Recombinant Human Kallikrein 13 expressed in: chemical synthesis

KLK13 Kallikrein-13 Human Recombinant Protein
PROTQ9UKR3	BosterBio	Regular: 5ug	EUR 317
Description: KLK13 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 284 amino acids (17-277 a.a) and having a molecular mass of 31.3kDa.;KLK13 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human)
4-PAD373Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Glu22~Gln277) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13)

Recombinant Human Kallikrein 13/KLK13 (C-6His)
C362-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)
C362-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)
C362-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Recombinant Human Kallikrein 13/KLK13 (C-6His)
C362-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM MES, 150mM NaCl, 10% Glycerol, pH 5.5.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC
4-PAD373Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Glu22~Gln277) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Biotinylated
4-PAD373Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Glu22~Gln277) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Biotin.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), Cy3
4-PAD373Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Glu22~Gln277) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with Cy3.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), FITC
4-PAD373Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Glu22~Gln277) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with FITC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), HRP
4-PAD373Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Glu22~Gln277) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with HRP.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), PE
4-PAD373Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Glu22~Gln277) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with PE.

KLK13 Human, Kallikrein-13 Human Recombinant Protein, sf9
PROTQ9UKR3-1	BosterBio	Regular: 5ug	EUR 317
Description: KLK13 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 267 amino acids (17-277a.a.) and having a molecular mass of 29.7kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40kDa). KLK13 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Polyclonal KLK13 / Kallikrein 13 Antibody (aa262-277)
APR02667G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KLK13 / Kallikrein 13 (aa262-277). This antibody is tested and proven to work in the following applications:

Kallikrein 13 (KLK13) Polyclonal Antibody (Human), APC-Cy7
4-PAD373Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Glu22~Gln277) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat)
4-PAD373Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Val25~Ala261) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13)

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC
4-PAD373Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Val25~Ala261) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated
4-PAD373Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Val25~Ala261) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Biotin.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), Cy3
4-PAD373Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Val25~Ala261) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with Cy3.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), FITC
4-PAD373Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Val25~Ala261) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with FITC.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), HRP
4-PAD373Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Val25~Ala261) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with HRP.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), PE
4-PAD373Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Val25~Ala261) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with PE.

Kallikrein 13 (KLK13) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7
4-PAD373Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KLK13 (Val25~Ala261) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Kallikrein 13 (KLK13). This antibody is labeled with APC-Cy7.

99445-13 DCT 13 X 100MM
99445-13	CORNING	250/pk	EUR 76
Description: Disposable Culture Tubes; DCT's, CGW

anti-Kallikrein 13
YF-PA18203	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Kallikrein 13

99999 CAP 13-415
99999-13	CORNING	1000/pk	EUR 219
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Caps

Kallikrein 13 Protein (OVA)
20-abx165562	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Anti-Kallikrein 13 (1G9)
YF-MA18049	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Kallikrein 13

9998 SCREW CAP 415/13
9998-13	CORNING	288/pk	EUR 198
Description: General Apparatus; Stoppers

Human CellExp? Kallikrein-13, human recombinant
7413-10	Biovision		EUR 278

ELISA kit for Human KLK13
EK5504	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human KLK13 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human KLK13 PicoKine ELISA Kit
EK1168	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human KLK13 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

KLK13 ELISA Kit (Human) (OKCD00765)
OKCD00765	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.6 pg/mL

KLK13 ELISA Kit (Human) (OKBB00909)
OKBB00909	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Kallikrein-13 is a protein that in humans is encoded by the KLK13 gene. It belongs to the kallikrein subgroup of serine proteases, which have diverse physiologic functions in many tissues. By genomic sequence analysis, KLK13 gene is mapped in a 300-kb region on chromosome 19q13.3-q13.4. It has been shown that recombinant hK13 produced in yeast can cleave synthetic peptides after the arginine residue and some extracellular matrix components. However, its exact physiological substrates and functions remain obscure. Despite the lack of knowledge on the physiological function of hK13, several studies have demonstrated that hK13 is implicated with cancer of the breast and ovary and it can serve as a favorable prognostic biomarker for these malignancies.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

99447 DSSCT 13 X 100MM W/ MARING SPOT
99447-13	CORNING	250/pk	EUR 332
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

99449 DSSCT 13 X 100MM W/O MARKING SPOT
99449-13	CORNING	250/pk	EUR 281
Description: Disposable Screw Cap Culture Tubes; DSCCT's, Lab Stock

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

CA199 (Cancer antigen) ELISA test
13	Biobase	96T/Box	Ask for price
Area of application: Hormone testing
Description: ELISA based test for quantitative detection of CA199 (Cancer antigen)

KLK13 siRNA
20-abx921819	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KLK13 protein
80R-4293	Fitzgerald	20 ug	EUR 327
Description: Purified Recombinant KLK13 protein (His tagged)

KLK13 antibody
70R-3265	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal KLK13 antibody raised against the middle region of KLK13

KLK13 Antibody
36578-100ul	SAB	100ul	EUR 252

KLK13 Antibody
1-CSB-PA374084	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

KLK13 Antibody
1-CSB-PA185718	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KLK13. Recognizes KLK13 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

Human KalliKrein 1 ELISA kit
E01K0026-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human KalliKrein 1 ELISA kit
E01K0026-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human KalliKrein 1 ELISA kit
E01K0026-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human KalliKrein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 10 ELISA kit
E01K0070-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 10 ELISA kit
E01K0070-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 10 ELISA kit
E01K0070-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 10 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 11 ELISA kit
E01K0072-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 11 ELISA kit
E01K0072-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 11 ELISA kit
E01K0072-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 11 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 6 ELISA kit
E01K0073-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 6 ELISA kit
E01K0073-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 6 ELISA kit
E01K0073-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 6 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 7 ELISA kit
E01K0074-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 7 ELISA kit
E01K0074-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 7 ELISA kit
E01K0074-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 7 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 8 ELISA kit
E01K0075-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 8 ELISA kit
E01K0075-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 8 ELISA kit
E01K0075-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 8 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 2 ELISA kit
E01K0077-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 2 ELISA kit
E01K0077-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 2 ELISA kit
E01K0077-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 3 ELISA kit
E01K0078-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 3 ELISA kit
E01K0078-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 3 ELISA kit
E01K0078-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 5 ELISA kit
E01K0079-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 5 ELISA kit
E01K0079-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 5 ELISA kit
E01K0079-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Kallikrein 5 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Kallikrein 2 ELISA Kit
ELA-E0278h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 9 ELISA Kit
ELA-E0408h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 11 ELISA Kit
ELA-E0669h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 8 ELISA Kit
ELA-E0690h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 6 ELISA Kit
ELA-E0691h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 10 ELISA Kit
ELA-E0697h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 1 ELISA Kit
ELA-E0967h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 7 ELISA Kit
ELA-E1910h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 3 ELISA Kit
ELA-E8720h	Lifescience Market	96 Tests	EUR 824

Human Kallikrein 6 ELISA Kit
ELA-E8916h	Lifescience Market	96 Tests	EUR 824

Kallikrein 11 ELISA KIT|Human
EF010428	Lifescience Market	96 Tests	EUR 689

Human Kallikrein 3 ELISA Kit
55R-1761	Fitzgerald	1 kit	EUR 651
Description: ELISA kit for detection of Kallikrein 3 in the research laboratory

Human Kallikrein-6 ELISA Kit
LF-EK50923	Abfrontier	1×96T	EUR 648

Human Kallikrein 14 ELISA Kit
LF-EK50970	Abfrontier	1×96T	EUR 648

Human KLK13 shRNA Plasmid
20-abx958699	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KLK13 Recombinant Protein (Human)
RP017230	ABM	100 ug	Ask for price

Human IL-13(Interleukin 13) ELISA Kit
EH3266	FN Test	96T	EUR 476.25
Detection range: 15.625-1000 pg/ml Uniprot ID: P35225 Alias: IL-13(Interleukin 13)/BHR1interleukin-13
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human cytokeratin 13(CK-13)ELISA Kit
GA-E1624HM-48T	GenAsia Biotech	48T	EUR 289

Human cytokeratin 13(CK-13)ELISA Kit
GA-E1624HM-96T	GenAsia Biotech	96T	EUR 466

Human Interleukin 13(IL-13)ELISA Kit
GA-E0138HM-48T	GenAsia Biotech	48T	EUR 289

Human Interleukin 13(IL-13)ELISA Kit
GA-E0138HM-96T	GenAsia Biotech	96T	EUR 466

Human Interleukin 13,IL-13 ELISA KIT
201-12-0099	SunredBio	96 tests	EUR 440
This Interleukin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human cytokeratin 13,CK-13 ELISA Kit
201-12-1608	SunredBio	96 tests	EUR 440
This cytokeratin 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Interleukin 13, IL-13 ELISA KIT
CSB-E04601h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Interleukin 13, IL-13 ELISA KIT
1-CSB-E04601h	Cusabio	EUR 603.00 EUR 4247.00 EUR 2260.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Interleukin 13, IL-13 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Interleukin 13,IL-13 ELISA KIT
CN-03217H1	ChemNorm	96T	EUR 434

Human Interleukin 13,IL-13 ELISA KIT
CN-03217H2	ChemNorm	48T	EUR 284

Human Interleukin-13 (IL-13) ELISA Kit
LF-EK60050	Abfrontier	1×96T	EUR 790

Human Interleukin 13(IL-13)ELISA Kit
QY-E04326	Qayee Biotechnology	96T	EUR 361

Human cytokeratin 13(CK-13)ELISA Kit
QY-E00980	Qayee Biotechnology	96T	EUR 361

Human ADAMTS -13(ADAMTS -13) ELISA Kit
QY-E05516	Qayee Biotechnology	96T	EUR 361

KLK13 Conjugated Antibody
C36578	SAB	100ul	EUR 397

KLK13 Polyclonal Antibody
ES11092-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against KLK13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

KLK13 Polyclonal Antibody
ES11092-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against KLK13 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

KLK13 Polyclonal Antibody
ABP59062-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human KLK13 protein Applications tips:
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

KLK13 Polyclonal Antibody
ABP59062-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human KLK13 protein Applications tips:
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

KLK13 Polyclonal Antibody
ABP59062-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human KLK13 protein Applications tips:
Description: A polyclonal antibody for detection of KLK13 from Human. This KLK13 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human KLK13 protein

KLK13 Rabbit pAb
A14274-100ul	Abclonal	100 ul	EUR 308

KLK13 Rabbit pAb
A14274-200ul	Abclonal	200 ul	EUR 459

KLK13 Rabbit pAb
A14274-20ul	Abclonal	20 ul	EUR 183

KLK13 Rabbit pAb
A14274-50ul	Abclonal	50 ul	EUR 223

KLK13 Blocking Peptide
33R-9689	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KLK13 antibody, catalog no. 70R-3265

KLK13 cloning plasmid
CSB-CL891952HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 834 Sequence: atgtggcccctggccctagtgatcgcctccctgaccttggccttgtcaggaggtgtctcccaggagtcttccaaggttctcaacaccaatgggaccagtgggtttctcccaggtggctacacctgcttcccccactctcagccctggcaggctgccctactagtgcaagggcggct Show more
Description: A cloning plasmid for the KLK13 gene.

Anti-KLK13 antibody
STJ116486	St John's Laboratory	100 µl	EUR 277
Description: Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Expression of this gene is regulated by steroid hormones and may be useful as a marker for breast cancer. An additional transcript variant has been identified, but its full length sequence has not been determined.

Anti-KLK13 antibody
STJ192250	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to KLK13

Human CK-13/KRT13(Cytokeratin 13) ELISA Kit
EH2818	FN Test	96T	EUR 524.1
Detection range: 15.625-1000 pg/ml Uniprot ID: P13646 Alias: CK-13/KRT13/Cytokeratin-13/CK-13/Keratin-13/K13/Keratin, type I cytoskeletal 13
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 9.375pg/ml

Human Matrix metalloproteinase 13(MMP-13)ELISA Kit
GA-E0928HM-48T	GenAsia Biotech	48T	EUR 289

Human Matrix metalloproteinase 13(MMP-13)ELISA Kit
GA-E0928HM-96T	GenAsia Biotech	96T	EUR 466

Human Matrix metalloproteinase 13,MMP-13 ELISA kit
201-12-0912	SunredBio	96 tests	EUR 440
This Matrix metalloproteinase 13 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Matrix metalloproteinase 13, MMP-13 ELISA kit
CSB-E04674h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase 13, MMP-13 in samples from serum, cell culture supernates, urine, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Matrix metalloproteinase 13, MMP-13 ELISA kit
1-CSB-E04674h	Cusabio	EUR 723.00 EUR 4883.00 EUR 2591.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrix metalloproteinase 13, MMP-13 in samples from serum, cell culture supernates, urine, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Matrix metalloproteinase 13,MMP-13 ELISA kit
CN-03225H1	ChemNorm	96T	EUR 448

Human Matrix metalloproteinase 13,MMP-13 ELISA kit
CN-03225H2	ChemNorm	48T	EUR 297

ELISA kit for Human IL-13 (Interleukin 13)
E-EL-H0104	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's IL-13 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human IL-13. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human IL-13 (Interleukin 13) in samples from Serum, Plasma, Cell supernatant

Human Matrix metalloproteinase 13(MMP-13)ELISA Kit
QY-E02998	Qayee Biotechnology	96T	EUR 361

Human Kallikrein 1 (KLK1) ELISA Kit
CEA967Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

Human Kallikrein 1 (KLK1) ELISA Kit
CEA967Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

Human Kallikrein 1 (KLK1) ELISA Kit
CEA967Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

Human Kallikrein 1 (KLK1) ELISA Kit
CEA967Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 1 (KLK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 1 (KLK1) in serum, plasma and other biological fluids.

Human Kallikrein 1 (KLK1) ELISA Kit
4-CEA967Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kallikrein 1 elisa. Alternative names of the recognized antigen: KLKR Klk6 HK1 Kallikrein 1, Renal/Pancreas/Salivary Kidney/pancreas/salivary gland kallikrein Tissue kallikrein
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 1 (KLK1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Kallikrein 12 (KLK12) ELISA Kit
CED372Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 12 (KLK12) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 12 (KLK12) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 12 (KLK12) ELISA Kit
CED372Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 12 (KLK12) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 12 (KLK12) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 12 (KLK12) ELISA Kit
CED372Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 12 (KLK12) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 12 (KLK12) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 12 (KLK12) ELISA Kit
CED372Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 12 (KLK12) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 12 (KLK12) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 12 (KLK12) ELISA Kit
4-CED372Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kallikrein 12 elisa. Alternative names of the recognized antigen: KLK-L5 KLKL5 Kallikrein-Related Peptidase 12 Kallikrein-like protein 5
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 12 (KLK12) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Kallikrein 14 (KLK14) ELISA Kit
CED374Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 14 (KLK14) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 14 (KLK14) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 14 (KLK14) ELISA Kit
CED374Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 14 (KLK14) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 14 (KLK14) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 14 (KLK14) ELISA Kit
CED374Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 14 (KLK14) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 14 (KLK14) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 14 (KLK14) ELISA Kit
CED374Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 14 (KLK14) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 14 (KLK14) in serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 14 (KLK14) ELISA Kit
4-CED374Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kallikrein 14 elisa. Alternative names of the recognized antigen: KLK-L6 Kallikrein-like protein 6
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 14 (KLK14) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Kallikrein 8 (KLK8) ELISA Kit
CEA690Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 8 (KLK8) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 8 (KLK8) in serum, plasma and other biological fluids.

Human Kallikrein 8 (KLK8) ELISA Kit
CEA690Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 8 (KLK8) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 8 (KLK8) in serum, plasma and other biological fluids.

Human Kallikrein 8 (KLK8) ELISA Kit
CEA690Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 8 (KLK8) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 8 (KLK8) in serum, plasma and other biological fluids.

Human Kallikrein 8 (KLK8) ELISA Kit
CEA690Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 8 (KLK8) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 8 (KLK8) in serum, plasma and other biological fluids.

Human Kallikrein 8 (KLK8) ELISA Kit
4-CEA690Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kallikrein 8 elisa. Alternative names of the recognized antigen: NP HNP NRPN PRSS19 TADG14 BSP1 Neuropsin Ovasin Brain Serine Protease 1 Tumor Associated Differentially Expressed Gene 14 Serine protease 19
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 8 (KLK8) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Kallikrein 6 (KLK6) ELISA Kit
CEA691Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4011.55
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 6 (KLK6) in serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk and other biological fluids.

Human Kallikrein 6 (KLK6) ELISA Kit
CEA691Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 418.01
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 6 (KLK6) in serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk and other biological fluids.

Human Kallikrein 6 (KLK6) ELISA Kit
CEA691Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 554.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 6 (KLK6) in serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk and other biological fluids.

Human Kallikrein 6 (KLK6) ELISA Kit
CEA691Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2194.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 6 (KLK6) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 6 (KLK6) in serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk and other biological fluids.

Human Kallikrein 6 (KLK6) ELISA Kit
4-CEA691Hu	Cloud-Clone	EUR 4062.00 EUR 2145.00 EUR 555.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kallikrein 6 elisa. Alternative names of the recognized antigen: ZYME Bssp Klk7 Neurosin, Zyme PRSS18 PRSS9 SP59 HK6 Protease M Serine protease 18
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 6 (KLK6) in samples from Serum, plasma, tissue homogenates, cerebrospinal fluid, breast milk and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Kallikrein 10 (KLK10) ELISA Kit
CEA697Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 3160.7
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 10 (KLK10) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 10 (KLK10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Kallikrein 10 (KLK10) ELISA Kit
CEA697Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 347.94
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 10 (KLK10) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 10 (KLK10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Kallikrein 10 (KLK10) ELISA Kit
CEA697Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 454.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 10 (KLK10) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 10 (KLK10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Kallikrein 10 (KLK10) ELISA Kit
CEA697Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 1743.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Kallikrein 10 (KLK10) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Kallikrein 10 (KLK10) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Kallikrein 10 (KLK10) ELISA Kit
4-CEA697Hu	Cloud-Clone	EUR 3211.00 EUR 1694.00 EUR 455.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Kallikrein 10 elisa. Alternative names of the recognized antigen: NES1 PRSSL1 Kallikrein-Related Peptidase 10 Normal epithelial cell-specific 1 Protease serine-like 1
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Kallikrein 10 (KLK10) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Kallikrein 11 (KLK11) ELISA Kit
abx570232-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Kallikrein 9 (KLK9) ELISA Kit
abx570331-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Kallikrein 7 (KLK7) ELISA Kit
abx570405-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Kallikrein 2 (KLK2) ELISA Kit
abx570610-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Kallikrein 6 (KLK6) ELISA Kit
abx572058-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Kallikrein 4 (KLK4) ELISA Kit
abx572101-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Kallikrein 10 (KLK10) ELISA Kit
abx574301-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Kallikrein 8 (KLK8) ELISA Kit
abx575960-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Kallikrein 5 (KLK5) ELISA Kit
abx576328-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Kallikrein 1 (KLK1) ELISA Kit
abx576494-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human plasma kallikrein(KLKB1) ELISA kit
E01P0813-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human plasma kallikrein(KLKB1) ELISA kit
E01P0813-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human plasma kallikrein(KLKB1) ELISA kit
E01P0813-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human plasma kallikrein(KLKB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human Kallikrein-8
EK2128	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-8 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein-6
EK2130	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-6 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein-10
EK2137	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-10 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein-1
EK2486	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein-5
EK2862	SAB	96 tests	EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-5 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein-7
EK4077	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein-7 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein 3
EK5362	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein 3 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Kallikrein 14
EK5428	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Kallikrein 14 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Kallikrein 3 PicoKine ELISA Kit
EK0816	BosterBio	96 wells	EUR 456
Description: For quantitative detection of Human Kallikrein 3 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Human Kallikrein-6 PicoKine ELISA Kit
EK0818	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Kallikrein-6 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA) .

Human Kallikrein 14 PicoKine ELISA Kit
EK0949	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Kallikrein 14 in cell culture supernates, cell lysates, serum and plasma(heparin, EDTA).

Human KLK1/ Kallikrein-1 ELISA Kit
E1385Hu	Sunlong	1 Kit	EUR 571

Human KLK10/ Kallikrein-10 ELISA Kit
E1386Hu	Sunlong	1 Kit	EUR 571

Human KLK11/ Kallikrein-11 ELISA Kit
E1387Hu	Sunlong	1 Kit	EUR 571

Human KLK2/ Kallikrein-2 ELISA Kit
E1388Hu	Sunlong	1 Kit	EUR 571

Human KLK5/ Kallikrein-5 ELISA Kit
E1390Hu	Sunlong	1 Kit	EUR 537

Human KLK6/ Kallikrein-6 ELISA Kit
E1391Hu	Sunlong	1 Kit	EUR 571

Human KLK7/ Kallikrein-7 ELISA Kit
E1392Hu	Sunlong	1 Kit	EUR 571

Human KLK8/ Kallikrein-8 ELISA Kit
E1393Hu	Sunlong	1 Kit	EUR 571

Human KLK9/ Kallikrein-9 ELISA Kit
E1394Hu	Sunlong	1 Kit	EUR 571

Human KLK6(Kallikrein-6) ELISA Kit
EH0208	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: Q92876 Alias: KLK6/Kallikrein-6/Bssp/PRSS18/PRSS9/SP59/hK6/ZYME
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human KLK1(Kallikrein-1) ELISA Kit
EH0212	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: P06870 Alias: KLK1/KLK1/Kallikrein-1/Kidney/pancreas/salivary gland kallikrein/Tissue kallikrein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human KLK5(Kallikrein-5) ELISA Kit
EH0213	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q9Y337 Alias: KLK5/Kallikrein-like protein 2(KLK-L2)/Stratum corneum tryptic enzyme
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human KLK2(Kallikrein-2) ELISA Kit
EH0818	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P20151 Alias: KLK2(Kallikrein-2)/Glandular kallikrein-1(hGK-1)/Tissue kallikrein-2
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human KLK8(Kallikrein-8) ELISA Kit
EH1009	FN Test	96T	EUR 524.1
Detection range: 0.781-50 ng/ml Uniprot ID: O60259 Alias: KLK8(Kallikrein 8)/Neuropsin/Ovasin/PRSS19/hK8/HNP/kallikrein 8(neuropsin/ovasin)/kallikrein-related peptidase 8/KLK8 protein type 1/KLK8 protein type 2/neuropsin type 1/neuropsin type 2/NP/NR Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml