Human EFNB1(Ephrin B1) ELISA Kit

Human EFNB1(Ephrin B1) ELISA Kit

To Order Contact us: 

    Human Ephrin- B1, EFNB1 ELISA KIT

    ELI-26084h 96 Tests
    EUR 824

    Human Ephrin B1 (EFNB1) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ephrin B1(EFNB1)ELISA Kit  

    QY-E03397 96T
    EUR 361

    Human Ephrin B1 (EFNB1) ELISA Kit

    SEE114Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B1 (EFNB1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B1 (EFNB1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin B1 (EFNB1) ELISA Kit

    SEE114Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B1 (EFNB1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B1 (EFNB1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin B1 (EFNB1) ELISA Kit

    SEE114Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B1 (EFNB1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B1 (EFNB1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin B1 (EFNB1) ELISA Kit

    SEE114Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B1 (EFNB1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B1 (EFNB1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin B1 (EFNB1) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ephrin B1 elisa. Alternative names of the recognized antigen: CFND
    • CFNS
    • EFL3
    • EPLG2
    • Elk-L
    • LERK2
    • EPH-related receptor tyrosine kinase ligand 2
    • Craniofrontonasal Syndrome(Craniofrontonasal Dysplasia)
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ephrin B1 (EFNB1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Ephrin B1 (EFNB1) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Ephrin B1 (EFNB1) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Ephrin B1 (EFNB1) Antibody

    abx031383-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Ephrin B1 (EFNB1) Antibody

    abx031383-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Ephrin B1 (EFNB1) Antibody

    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Ephrin B1 (EFNB1) Antibody

    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Ephrin B1 (EFNB1) Antibody

    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Ephrin B1 (EFNB1) Antibody

    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Chicken Ephrin- B1, EFNB1 ELISA KIT

    ELI-32730c 96 Tests
    EUR 928

    Mouse Ephrin- B1, Efnb1 ELISA KIT

    ELI-47574m 96 Tests
    EUR 865

    Human Ephrin B1 (EFNB1) Protein

    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Human Ephrin B1 (EFNB1) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human EFNB1 (Ephrin B1)

    ELK4923 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Ephrin B1 (EFNB1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Ephrin B1 (EFNB1
    • Show more
    Description: A sandwich ELISA kit for detection of Ephrin B1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    EFNB1 Ephrin-B1 Human Recombinant Protein

    PROTP98172 Regular: 20ug
    EUR 317
    Description: EFNB1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 231 amino acids (28-237) and having a molecular mass of 25.3 kDa.;The EFNB1 is fused to a 21 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

    Recombinant Human Ephrin-B1/EFNB1 (C-6His)

    CC54-10ug 10ug
    EUR 146
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Recombinant Human Ephrin-B1/EFNB1 (C-6His)

    CC54-1mg 1mg
    EUR 2283
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Recombinant Human Ephrin-B1/EFNB1 (C-6His)

    CC54-500ug 500ug
    EUR 1613
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Recombinant Human Ephrin-B1/EFNB1 (C-6His)

    CC54-50ug 50ug
    EUR 339
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Ephrin B1 Phospho-Tyr317 (EFNB1 pY317) Antibody

    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Recombinant Mouse Ephrin-B1/EFNB1 (C-Fc-6His)

    CJ23-10ug 10ug
    EUR 80
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Recombinant Mouse Ephrin-B1/EFNB1 (C-Fc-6His)

    CJ23-1mg 1mg
    EUR 608
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Recombinant Mouse Ephrin-B1/EFNB1 (C-Fc-6His)

    CJ23-500ug 500ug
    EUR 461
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Recombinant Mouse Ephrin-B1/EFNB1 (C-Fc-6His)

    CJ23-50ug 50ug
    EUR 131
    Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

    Ephrin B1 (Ephrin B1) Antibody

    abx232810-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Ephrin B1 ELISA KIT|Human

    EF009414 96 Tests
    EUR 689

    Ephrin B1

    PR27094 5 ug
    EUR 191

    Human Ephrin B1 Antibody

    33295-05111 150 ug
    EUR 261

    Ephrin B1 Protein

    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    Ephrin B1 antibody

    70R-49688 100 ul
    EUR 287
    Description: Purified Polyclonal Ephrin B1 antibody

    Ephrin-B1 antibody

    70R-6117 50 ug
    EUR 467
    Description: Rabbit polyclonal Ephrin-B1 antibody raised against the middle region of EFNB1

    Efnb1/ Rat Efnb1 ELISA Kit

    ELI-26048r 96 Tests
    EUR 886

    Recombinant Human Ephrin-B1 Protein

    RP00092 20 μg
    EUR 193

    Recombinant Human Ephrin-B1 Protein

    RP00250 20 μg
    EUR 202

    anti- Ephrin B1 antibody

    FNab02810 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:1000
    • Immunogen: ephrin-B1
    • Uniprot ID: P98172
    • Research Area: Signal Transduction, Metabolism, Cardiovascular, Cancer, Developmental biology, Neuroscience
    Description: Antibody raised against Ephrin B1

    Ephrin-B1 Polyclonal Antibody

    ES2280-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Ephrin-B1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Ephrin-B1 Polyclonal Antibody

    ES2280-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Ephrin-B1 from Human/Mouse/Rat/Monkey. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Ephrin B1 / 2 Antibody

    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Ephrin-B1 Polyclonal Antibody

    ABP51281-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1 around the non-phosphorylation site of Y317
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1 from Human, Mouse, Rat, Monkey. This Ephrin-B1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1 around the non-phosphorylation site of Y317

    Ephrin-B1 Polyclonal Antibody

    ABP51281-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1 around the non-phosphorylation site of Y317
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1 from Human, Mouse, Rat, Monkey. This Ephrin-B1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1 around the non-phosphorylation site of Y317

    Ephrin-B1 Polyclonal Antibody

    ABP51281-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1 around the non-phosphorylation site of Y317
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1 from Human, Mouse, Rat, Monkey. This Ephrin-B1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1 around the non-phosphorylation site of Y317

    Ephrin B1 (pT317) Antibody

    • EUR 314.00
    • EUR 467.00
    • EUR 203.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Ephrin-B1 Blocking Peptide

    33R-8768 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EFNB1 antibody, catalog no. 70R-6117

    Anti-Ephrin B1 antibody

    PAab02810 100 ug
    EUR 355

    Anti-Ephrin-B1 antibody

    STJ92959 200 µl
    EUR 197
    Description: Rabbit polyclonal to Ephrin-B1.

    Human Ephrin B1 Antibody (Biotin Conjugate)

    33295-05121 150 ug
    EUR 369

    Polyclonal Ephrin-B1 (extracellular) Antibody

    APR11876G 0.05ml
    EUR 659
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Ephrin-B1 (extracellular) . This antibody is tested and proven to work in the following applications:

    Ephrin-B1/2 Polyclonal Antibody

    ES2281-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Ephrin-B1/2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    Ephrin-B1/2 Polyclonal Antibody

    ES2281-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Ephrin-B1/2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    Ephrin B1 / 2 Blocking Peptide

    • EUR 606.00
    • EUR 1428.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    Ephrin B1 (pY317) Blocking Peptide

    • EUR 314.00
    • EUR 509.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    Ephrin-B1/2 Polyclonal Antibody

    ABP51282-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2 around the non-phosphorylation site of Y330
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2 from Human, Mouse, Rat. This Ephrin-B1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2 around the non-phosphorylation site of Y330

    Ephrin-B1/2 Polyclonal Antibody

    ABP51282-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2 around the non-phosphorylation site of Y330
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2 from Human, Mouse, Rat. This Ephrin-B1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2 around the non-phosphorylation site of Y330

    Ephrin-B1/2 Polyclonal Antibody

    ABP51282-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2 around the non-phosphorylation site of Y330
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2 from Human, Mouse, Rat. This Ephrin-B1/2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2 around the non-phosphorylation site of Y330

    Anti-Ephrin-B1/2 Antibody

    A02767 100ul
    EUR 397
    Description: Rabbit Polyclonal Antibody for Ephrin-B1/2 Antibody (EFNB1) detection.tested for WB in Human, Mouse, Rat.

    Ephrin B1/B2 antibody (Tyr329)

    70R-34395 100 ug
    EUR 327
    Description: Rabbit polyclonal Ephrin B1/B2 antibody (Tyr329)

    Ephrin-B1/2 Polyclonal Antibody

    40894-100ul 100ul
    EUR 252

    Ephrin-B1/2 Polyclonal Antibody

    40894-50ul 50ul
    EUR 187

    Anti-Ephrin-B1/2 antibody

    STJ92960 200 µl
    EUR 197
    Description: Rabbit polyclonal to Ephrin-B1/2.

    Anti-Ephrin Receptor B1 Antibody

    STJ500930 100 µg
    EUR 476

    EFNB1 ELISA Kit (Human) (OKCD01804)

    OKCD01804 96 Wells
    EUR 831
    Description: Description of target: Binds to the receptor tyrosine kinases EPHB1 and EPHA1. Binds to, and induce the collapse of, commissural axons/growth cones in vitro. May play a role in constraining the orientation of longitudinally projecting axons.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.067 ng/mL

    Bovine IL-10 ELISA Kit

    DEIABL-B1 96T
    EUR 689
    Description: This CD Bovine IL-10 ELISA kit is a 1.5 hour solid-phase ELISA designed for the quantitative determination of Bovine IL-10. This ELISA kit for research use only, not for therapeutic or diagnostic applications!

    Human Ephrin B1 AssayLite Antibody (FITC Conjugate)

    33295-05141 150 ug
    EUR 428

    Human Ephrin B1 AssayLite Antibody (RPE Conjugate)

    33295-05151 150 ug
    EUR 428

    Human Ephrin B1 AssayLite Antibody (APC Conjugate)

    33295-05161 150 ug
    EUR 428

    Human Ephrin B1 AssayLite Antibody (PerCP Conjugate)

    33295-05171 150 ug
    EUR 471

    Recombinant (E.Coli, His-tag) Human Ephrin B1

    RP-937 2 ug
    EUR 347

    Ephrin-B1/2 Polyclonal Conjugated Antibody

    C40894 100ul
    EUR 397

    Ephrin-B1 (phospho Tyr317) Polyclonal Antibody

    ES5045-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Ephrin-B1 (phospho Tyr317) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Ephrin-B1 (phospho Tyr317) Polyclonal Antibody

    ES5045-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Ephrin-B1 (phospho Tyr317) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Ephrin B1 / B2 (Phospho-Tyr329) Antibody

    • EUR 314.00
    • EUR 98.00
    • EUR 398.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 200 ug
    • 300 µg
    • Shipped within 5-10 working days.

    Ephrin-B1 (phospho Tyr317) Polyclonal Antibody

    ABP54046-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1 around the phosphorylation site of Y317
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1 phospho Tyr317) from Human, Mouse, Rat. This Ephrin-B1 phospho Tyr317) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1 around the phosphorylation site of Y317

    Ephrin-B1 (phospho Tyr317) Polyclonal Antibody

    ABP54046-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1 around the phosphorylation site of Y317
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1 phospho Tyr317) from Human, Mouse, Rat. This Ephrin-B1 phospho Tyr317) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1 around the phosphorylation site of Y317

    Ephrin-B1 (phospho Tyr317) Polyclonal Antibody

    ABP54046-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1 around the phosphorylation site of Y317
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1 phospho Tyr317) from Human, Mouse, Rat. This Ephrin-B1 phospho Tyr317) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1 around the phosphorylation site of Y317

    Ephrin B1/B2/B3 antibody (Tyr324)

    70R-34448 100 ug
    EUR 327
    Description: Rabbit polyclonal Ephrin B1/B2/B3 antibody (Tyr324)

    Anti-Phospho-Ephrin-B1 (Y317) antibody

    STJ90516 200 µl
    EUR 197
    Description: Rabbit polyclonal to Phospho-Ephrin-B1 (Y317).

    Anti-Ephrin Receptor B1 Antibody BIOTIN

    STJ500931 100 µg
    EUR 586

    Anti-Ephrin Receptor B1 Antibody FITC

    STJ500932 100 µg
    EUR 586

    Ephrin B1/B2 (Phospho-Tyr330) Colorimetric Cell-Based ELISA Kit

    EKC1941 100ul
    EUR 572

    Ephrin-B1/2 (phospho Tyr330) Polyclonal Antibody

    ES1419-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Ephrin-B1/2 (phospho Tyr330) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Ephrin-B1/2 (phospho Tyr330) Polyclonal Antibody

    ES1419-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Ephrin-B1/2 (phospho Tyr330) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Ephrin-B1/2 (phospho Tyr329) Polyclonal Antibody

    ES5046-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Ephrin-B1/2 (phospho Tyr329) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

    Ephrin-B1/2 (phospho Tyr329) Polyclonal Antibody

    ES5046-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Ephrin-B1/2 (phospho Tyr329) from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

    Ephrin-B1/2 (phospho Tyr330) Polyclonal Antibody

    ABP50420-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y330
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2 phospho Tyr330) from Human, Mouse, Rat. This Ephrin-B1/2 phospho Tyr330) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y330

    Ephrin-B1/2 (phospho Tyr330) Polyclonal Antibody

    ABP50420-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y330
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2 phospho Tyr330) from Human, Mouse, Rat. This Ephrin-B1/2 phospho Tyr330) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y330

    Ephrin-B1/2 (phospho Tyr330) Polyclonal Antibody

    ABP50420-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y330
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2 phospho Tyr330) from Human, Mouse, Rat. This Ephrin-B1/2 phospho Tyr330) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y330

    Phospho-Ephrin B1 / B2 / B3 (Tyr324) Antibody

    abx149198-100ug 100 ug
    EUR 439
    • Shipped within 5-10 working days.

    Ephrin B1 / B2 / B3 (Phospho-Tyr324) Antibody

    • EUR 314.00
    • EUR 98.00
    • EUR 398.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 200 ug
    • 300 µg
    • Shipped within 5-10 working days.

    Ephrin-B1/2 (phospho Tyr329) Polyclonal Antibody

    ABP54047-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y329
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2 phospho Tyr329) from Human, Mouse, Rat. This Ephrin-B1/2 phospho Tyr329) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y329

    Ephrin-B1/2 (phospho Tyr329) Polyclonal Antibody

    ABP54047-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y329
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2 phospho Tyr329) from Human, Mouse, Rat. This Ephrin-B1/2 phospho Tyr329) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y329

    Ephrin-B1/2 (phospho Tyr329) Polyclonal Antibody

    ABP54047-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y329
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2 phospho Tyr329) from Human, Mouse, Rat. This Ephrin-B1/2 phospho Tyr329) antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2 around the phosphorylation site of Y329

    Phospho- Ephrin B1/B2/B3 (Tyr324) Antibody

    ABD8737 100 ug
    EUR 438

    Phospho-Ephrin B1/B2/B3 (Tyr324) Antibody

    DF8737 200ul
    EUR 304
    Description: Phospho-Ephrin B1/B2/B3 (Tyr324) Antibody detects endogenous levels of Ephrin B1/B2/B3 only when phosphorylated at Tyr324.

    Anti-Phospho-Ephrin-B1/2 (Y330) antibody

    STJ90444 200 µl
    EUR 197
    Description: Rabbit polyclonal to Phospho-Ephrin-B1/2 (Y330).

    Anti-Phospho-Ephrin-B1/2 (Y329) antibody

    STJ91226 200 µl
    EUR 197
    Description: Rabbit polyclonal to Phospho-Ephrin-B1/2 (Y329).

    Phospho-Ephrin B1/B2 (Tyr330) Colorimetric Cell-Based ELISA Kit (OKAG01464)

    OKAG01464 2 x 96 Wells
    EUR 740
    Description: Description of target: ;Species reactivity: Human: Y330, Mouse: Y333, Rat: Y342;Application: ELISA;Assay info: Assay Type: Cell-Based
    Subtype: Phospho
    Detection Method: Colorimetric 450 nm;Sensitivity:

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Human Ephrin A1 ELISA kit

    E01E0042-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ephrin A1 ELISA kit

    E01E0042-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Ephrin A1 ELISA kit

    E01E0042-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Ephrin A1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Ephrin-B1/2/3 (phospho Tyr324) Polyclonal Antibody

    ES5047-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Ephrin-B1/2/3 (phospho Tyr324) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    Ephrin-B1/2/3 (phospho Tyr324) Polyclonal Antibody

    ES5047-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Ephrin-B1/2/3 (phospho Tyr324) from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

    Ephrin-B1/2/3 (phospho Tyr324) Polyclonal Antibody

    ABP54048-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2/3 around the phosphorylation site of Y324
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2/3 phospho Tyr324) from Human, Mouse, Rat. This Ephrin-B1/2/3 phospho Tyr324) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2/3 around the phosphorylation site of Y324

    Ephrin-B1/2/3 (phospho Tyr324) Polyclonal Antibody

    ABP54048-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2/3 around the phosphorylation site of Y324
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2/3 phospho Tyr324) from Human, Mouse, Rat. This Ephrin-B1/2/3 phospho Tyr324) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2/3 around the phosphorylation site of Y324

    Ephrin-B1/2/3 (phospho Tyr324) Polyclonal Antibody

    ABP54048-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from human Ephrin-B1/2/3 around the phosphorylation site of Y324
    • Applications tips:
    Description: A polyclonal antibody for detection of Ephrin-B1/2/3 phospho Tyr324) from Human, Mouse, Rat. This Ephrin-B1/2/3 phospho Tyr324) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Ephrin-B1/2/3 around the phosphorylation site of Y324

    Phospho-Ephrin B1/B2/B3 (Tyr324) Blocking Peptide

    DF8737-BP 1mg
    EUR 195

    Anti-Phospho-Ephrin-B1/2/3 (Y324) antibody

    STJ90972 200 µl
    EUR 197
    Description: Rabbit polyclonal to Phospho-Ephrin-B1/2/3 (Y324).

    EFNB1 Antibody

    AF7840 200ul
    EUR 376
    Description: EFNB1 Antibody detects endogenous levels of EFNB1.

    EFNB1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    EFNB1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    EFNB1 antibody

    70R-33575 100 ug
    EUR 327
    Description: Rabbit polyclonal EFNB1 antibody

    EFNB1 Antibody

    ABD6981 100 ug
    EUR 438

    EFNB1 antibody

    38414-100ul 100ul
    EUR 252

    EFNB1 Antibody

    43775-100ul 100ul
    EUR 252

    EFNB1 antibody

    70R-17013 50 ul
    EUR 435
    Description: Rabbit polyclonal EFNB1 antibody

    EFNB1 Antibody

    DF6981 200ul
    EUR 304
    Description: EFNB1 Antibody detects endogenous levels of total EFNB1.

    EFNB1 Antibody

    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against EFNB1. Recognizes EFNB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    EFNB1 Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against EFNB1. Recognizes EFNB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    EFNB1 Antibody

    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against EFNB1. Recognizes EFNB1 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

    EFNB1 Colorimetric Cell-Based ELISA Kit

    EKC1183 100ul
    EUR 572

    Human EFNB1 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    EFNB1 Recombinant Protein (Human)

    RP010270 100 ug Ask for price

    Human Vitamin B1 ELISA kit

    E01V0026-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vitamin B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vitamin B1 ELISA kit

    E01V0026-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vitamin B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vitamin B1 ELISA kit

    E01V0026-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Vitamin B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase B1 ELISA kit

    E01C0730-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase B1 ELISA kit

    E01C0730-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase B1 ELISA kit

    E01C0730-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Vitamin B1 Elisa Kit

    QY-E05439 96T
    EUR 361

    Ephrin B1/B2/B3 (phospho Y324/Y311/Y318) Antibody

    11780-100ul 100ul
    EUR 252

    Ephrin B1/B2/B3 (phospho Y324/Y311/Y318) Antibody

    11780-50ul 50ul
    EUR 187

    Recombinant Ephrin-B1 Protein (Leu 28-Gly 232) [His]

    VAng-1506Lsx-1mg 1 mg
    EUR 2745
    Description: Human Ephrin-B1 (EFNB1), His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_004420)

    Recombinant Ephrin-B1 Protein (Leu 28-Gly 232) [His]

    VAng-1506Lsx-200g 200 µg
    EUR 738
    Description: Human Ephrin-B1 (EFNB1), His tag, is expressed in HEK 293 cells. (Uniprot ID: NP_004420)

    Human Ephrin A2 (EFNA2) ELISA Kit

    abx512526-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Ephrin A3 (EFNA3) ELISA Kit

    abx571238-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    ELISA kit for Human Ephrin-A1

    EK3365 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Ephrin-A1 in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human EFNA1/ Ephrin-A1 ELISA Kit

    E0766Hu 1 Kit
    EUR 571

    Human EFNA2/ Ephrin-A2 ELISA Kit

    E0767Hu 1 Kit
    EUR 571

    Human EFNA3/ Ephrin-A3 ELISA Kit

    E0768Hu 1 Kit
    EUR 571

    Human EFNA1(Ephrin-A1) ELISA Kit

    EH1581 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P20827
    • Alias: EFNA1/Ephrin A1/EFNA1/TNF alpha induced protein 4/LERK1/EFL1/B61/ECKLG/EPLG1/TNFAIP4/Tumor necrosis factor alpha-induced protein 4/TNF alpha-induced protein 4/EPH-related receptor tyrosine kin
    • Show more
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human EFNA3(Ephrin A3) ELISA Kit

    EH2978 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P52797
    • Alias: EFNA3/EFL-2/Ehk1-L/LERK3/EFL2/EFL-2/EHK1-L/Ehk1-L/EPH-related receptor tyrosine kinase ligand 3/ephrin-A3/EPLG3EHK1 ligand/LERK3LERK-3/ligand of eph-related kinase 3
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human EFNA4(Ephrin A4) ELISA Kit

    EH2979 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: P52798
    • Alias: EFNA4/EFL-4/LERK-4/EFL4/EPH-related receptor tyrosine kinase ligand 4/EPLG4MGC125826/LERK-4/LERK4FLJ57652/ligand of eph-related kinase 4
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human EFNA5(Ephrin A5) ELISA Kit

    EH2980 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P52803
    • Alias: EFNA5/AL-1/EFL-5/LERK-7/RAGS/AF1/AL-1/EPH-related receptor tyrosine kinase ligand 7/EPLG7/GLC1M/LERK-7/LERK7EFL5/RAGS
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human Ephrin- B2, EFNB2 ELISA KIT

    ELI-26574h 96 Tests
    EUR 824

    Human Ephrin- A1, EFNA1 ELISA KIT

    ELI-04633h 96 Tests
    EUR 824

    Human Ephrin- B3, EFNB3 ELISA KIT

    ELI-47575h 96 Tests
    EUR 824

    Human Ephrin- A4, EFNA4 ELISA KIT

    ELI-32411h 96 Tests
    EUR 824

    Human Ephrin- A5, EFNA5 ELISA KIT

    ELI-32412h 96 Tests
    EUR 824

    Human Ephrin A2 (EFNA2) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ephrin A1 (EFNA1) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ephrin A3 (EFNA3) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ephrin A4 (EFNA4) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ephrin A5 (EFNA5) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ephrin B2 (EFNB2) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Ephrin A1 (EFNA1) ELISA Kit

    abx250871-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Ephrin A3 (EFNA3) ELISA Kit

    abx252367-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Ephrin A4 (EFNA4) ELISA Kit

    abx252368-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Ephrin A5 (EFNA5) ELISA Kit

    abx252370-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Ephrin A1 (EFNA1) ELISA Kit

    DLR-EFNA1-Hu-48T 48T
    EUR 517
    • Should the Human Ephrin A1 (EFNA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin A1 (EFNA1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Ephrin A1 (EFNA1) ELISA Kit

    DLR-EFNA1-Hu-96T 96T
    EUR 673
    • Should the Human Ephrin A1 (EFNA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin A1 (EFNA1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Ephrin A3 (EFNA3) ELISA Kit

    DLR-EFNA3-Hu-48T 48T
    EUR 517
    • Should the Human Ephrin A3 (EFNA3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin A3 (EFNA3) in samples from tissue homogenates or other biological fluids.

    Human Ephrin A3 (EFNA3) ELISA Kit

    DLR-EFNA3-Hu-96T 96T
    EUR 673
    • Should the Human Ephrin A3 (EFNA3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin A3 (EFNA3) in samples from tissue homogenates or other biological fluids.

    Human Ephrin A4 (EFNA4) ELISA Kit

    DLR-EFNA4-Hu-48T 48T
    EUR 517
    • Should the Human Ephrin A4 (EFNA4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin A4 (EFNA4) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Human Ephrin A4 (EFNA4) ELISA Kit

    DLR-EFNA4-Hu-96T 96T
    EUR 673
    • Should the Human Ephrin A4 (EFNA4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin A4 (EFNA4) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Human Ephrin A5 (EFNA5) ELISA Kit

    DLR-EFNA5-Hu-48T 48T
    EUR 517
    • Should the Human Ephrin A5 (EFNA5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin A5 (EFNA5) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Ephrin A5 (EFNA5) ELISA Kit

    DLR-EFNA5-Hu-96T 96T
    EUR 673
    • Should the Human Ephrin A5 (EFNA5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin A5 (EFNA5) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Ephrin B2 (EFNB2) ELISA Kit

    DLR-EFNB2-Hu-48T 48T
    EUR 517
    • Should the Human Ephrin B2 (EFNB2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin B2 (EFNB2) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Ephrin B2 (EFNB2) ELISA Kit

    DLR-EFNB2-Hu-96T 96T
    EUR 673
    • Should the Human Ephrin B2 (EFNB2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Ephrin B2 (EFNB2) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Ephrin-A1(EFNA1) ELISA kit

    CSB-EL007460HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ephrin-A1 (EFNA1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Ephrin-A1(EFNA1) ELISA kit

    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ephrin-A1(EFNA1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Ephrin-B2(EFNB2) ELISA kit

    CSB-EL007466HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ephrin-B2 (EFNB2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Ephrin-B2(EFNB2) ELISA kit

    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Ephrin-B2(EFNB2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Ephrin A4 ELISA Kit (EFNA4)

    RK01296 96 Tests
    EUR 521

    Human Ephrin B2 ELISA Kit (EFNB2)

    RK01297 96 Tests
    EUR 521

    Human Ephrin A1 (EFNA1) ELISA Kit

    RDR-EFNA1-Hu-48Tests 48 Tests
    EUR 544

    Human Ephrin A1 (EFNA1) ELISA Kit

    RDR-EFNA1-Hu-96Tests 96 Tests
    EUR 756

    Human Ephrin A3 (EFNA3) ELISA Kit

    RDR-EFNA3-Hu-48Tests 48 Tests
    EUR 544

    Human Ephrin A3 (EFNA3) ELISA Kit

    RDR-EFNA3-Hu-96Tests 96 Tests
    EUR 756

    Human Ephrin A4 (EFNA4) ELISA Kit

    RDR-EFNA4-Hu-48Tests 48 Tests
    EUR 544

    Human Ephrin A4 (EFNA4) ELISA Kit

    RDR-EFNA4-Hu-96Tests 96 Tests
    EUR 756

    Human Ephrin A5 (EFNA5) ELISA Kit

    RDR-EFNA5-Hu-48Tests 48 Tests
    EUR 544

    Human Ephrin A5 (EFNA5) ELISA Kit

    RDR-EFNA5-Hu-96Tests 96 Tests
    EUR 756

    Human Ephrin B2 (EFNB2) ELISA Kit

    RDR-EFNB2-Hu-48Tests 48 Tests
    EUR 544

    Human Ephrin B2 (EFNB2) ELISA Kit

    RDR-EFNB2-Hu-96Tests 96 Tests
    EUR 756

    Human Ephrin A1 (EFNA1) ELISA Kit

    RD-EFNA1-Hu-48Tests 48 Tests
    EUR 521

    Human Ephrin A1 (EFNA1) ELISA Kit

    RD-EFNA1-Hu-96Tests 96 Tests
    EUR 723

    Human Ephrin A3 (EFNA3) ELISA Kit

    RD-EFNA3-Hu-48Tests 48 Tests
    EUR 521

    Human Ephrin A3 (EFNA3) ELISA Kit

    RD-EFNA3-Hu-96Tests 96 Tests
    EUR 723

    Human Ephrin A4 (EFNA4) ELISA Kit

    RD-EFNA4-Hu-48Tests 48 Tests
    EUR 521

    Human Ephrin A4 (EFNA4) ELISA Kit

    RD-EFNA4-Hu-96Tests 96 Tests
    EUR 723

    Human Ephrin A5 (EFNA5) ELISA Kit

    RD-EFNA5-Hu-48Tests 48 Tests
    EUR 521

    Human Ephrin A5 (EFNA5) ELISA Kit

    RD-EFNA5-Hu-96Tests 96 Tests
    EUR 723

    Human Ephrin B2 (EFNB2) ELISA Kit

    RD-EFNB2-Hu-48Tests 48 Tests
    EUR 521

    Human Ephrin B2 (EFNB2) ELISA Kit

    RD-EFNB2-Hu-96Tests 96 Tests
    EUR 723

    Human Ephrin B3(EFNB3)ELISA Kit  

    QY-E03395 96T
    EUR 361

    Human Ephrin B2(EFNB2)ELISA Kit  

    QY-E03396 96T
    EUR 361

    Human Ephrin A5(EFNA5)ELISA Kit  

    QY-E03401 96T
    EUR 361

    Human Ephrin A4(EFNA4)ELISA Kit  

    QY-E03402 96T
    EUR 361

    Human Ephrin A2(EFNA2)ELISA Kit  

    QY-E03403 96T
    EUR 361

    Human Ephrin A1 (EFNA1) ELISA Kit

    SEE107Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A1 (EFNA1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A1 (EFNA1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ephrin A1 (EFNA1) ELISA Kit

    SEE107Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A1 (EFNA1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A1 (EFNA1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ephrin A1 (EFNA1) ELISA Kit

    SEE107Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A1 (EFNA1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A1 (EFNA1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ephrin A1 (EFNA1) ELISA Kit

    SEE107Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A1 (EFNA1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A1 (EFNA1) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ephrin A1 (EFNA1) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ephrin A1 elisa. Alternative names of the recognized antigen: B61
    • ECKLG
    • EFL1
    • EPLG1
    • LERK1
    • TNFAIP4
    • EPH-related receptor tyrosine kinase ligand 1
    • Tumor necrosis factor alpha-induced protein 4
    • Immediate early response protein B61
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ephrin A1 (EFNA1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Ephrin A2 (EFNA2) ELISA Kit

    SEE108Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A2 (EFNA2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A2 (EFNA2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin A2 (EFNA2) ELISA Kit

    SEE108Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A2 (EFNA2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A2 (EFNA2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin A2 (EFNA2) ELISA Kit

    SEE108Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A2 (EFNA2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A2 (EFNA2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin A2 (EFNA2) ELISA Kit

    SEE108Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A2 (EFNA2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A2 (EFNA2) in Tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin A2 (EFNA2) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ephrin A2 elisa. Alternative names of the recognized antigen: ELF-1
    • EPLG6
    • HEK7-L
    • LERK6
    • EPH-related receptor tyrosine kinase ligand 6
    • HEK7 ligand
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ephrin A2 (EFNA2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Ephrin A3 (EFNA3) ELISA Kit

    SEE109Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A3 (EFNA3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A3 (EFNA3) in Tissue homogenates and other biological fluids.

    Human Ephrin A3 (EFNA3) ELISA Kit

    SEE109Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A3 (EFNA3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A3 (EFNA3) in Tissue homogenates and other biological fluids.

    Human Ephrin A3 (EFNA3) ELISA Kit

    SEE109Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A3 (EFNA3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A3 (EFNA3) in Tissue homogenates and other biological fluids.

    Human Ephrin A3 (EFNA3) ELISA Kit

    SEE109Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A3 (EFNA3) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A3 (EFNA3) in Tissue homogenates and other biological fluids.

    Human Ephrin A3 (EFNA3) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ephrin A3 elisa. Alternative names of the recognized antigen: EFL2
    • EPLG3
    • Ehk1-L
    • LERK3
    • EHK1 ligand
    • EPH-related receptor tyrosine kinase ligand 3
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ephrin A3 (EFNA3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Ephrin A4 (EFNA4) ELISA Kit

    SEE110Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A4 (EFNA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A4 (EFNA4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin A4 (EFNA4) ELISA Kit

    SEE110Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A4 (EFNA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A4 (EFNA4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin A4 (EFNA4) ELISA Kit

    SEE110Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A4 (EFNA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A4 (EFNA4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin A4 (EFNA4) ELISA Kit

    SEE110Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A4 (EFNA4) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A4 (EFNA4) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Ephrin A4 (EFNA4) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ephrin A4 elisa. Alternative names of the recognized antigen: EFL4
    • EPLG4
    • LERK4
    • EPH-related receptor tyrosine kinase ligand 4
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ephrin A4 (EFNA4) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Ephrin A5 (EFNA5) ELISA Kit

    SEE111Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A5 (EFNA5) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A5 (EFNA5) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ephrin A5 (EFNA5) ELISA Kit

    SEE111Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A5 (EFNA5) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A5 (EFNA5) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ephrin A5 (EFNA5) ELISA Kit

    SEE111Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A5 (EFNA5) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A5 (EFNA5) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ephrin A5 (EFNA5) ELISA Kit

    SEE111Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin A5 (EFNA5) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin A5 (EFNA5) in serum, plasma, tissue homogenates and other biological fluids.

    Human Ephrin A5 (EFNA5) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ephrin A5 elisa. Alternative names of the recognized antigen: AF1
    • EFL5
    • EPLG7
    • GLC1M
    • LERK7
    • RAGS
    • AL-1
    • EPH-related receptor tyrosine kinase ligand 7
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ephrin A5 (EFNA5) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Ephrin B2 (EFNB2) ELISA Kit

    SEE112Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B2 (EFNB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ephrin B2 (EFNB2) ELISA Kit

    SEE112Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B2 (EFNB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ephrin B2 (EFNB2) ELISA Kit

    SEE112Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B2 (EFNB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ephrin B2 (EFNB2) ELISA Kit

    SEE112Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Ephrin B2 (EFNB2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Ephrin B2 (EFNB2) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Ephrin B2 (EFNB2) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Ephrin B2 elisa. Alternative names of the recognized antigen: EPLG5
    • HTKL
    • Htk-L
    • LERK5
    • HTK Ligand
    • Ligand Of Eph-Related Kinase 5
    • Eph-Related Receptor Tyrosine Kinase Ligand 5
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Ephrin B2 (EFNB2) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

    EFNB1 Colorimetric Cell-Based ELISA Kit (OKAG00682)

    OKAG00682 96 Wells
    EUR 596
    Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
    Subtype: None
    Detection Method: Colorimetric 450 nm;Sensitivity:

    Bovine Insulin ELISA Kit, 96 tests, Quantitative, 96 tests

    0030-10-B1 1 kit
    EUR 651

    EFNB1/2 Antibody

    AF6343 200ul
    EUR 304
    Description: EFNB1/2 Antibody detects endogenous levels of total EFNB1/2.

    EFNB1 Conjugated Antibody

    C38414 100ul
    EUR 397

    EFNB1/2 Antibody

    AF7821 200ul
    EUR 376
    Description: EFNB1/2 Antibody detects endogenous levels of EFNB1/2.

    EFNB1 Blocking Peptide

    AF7840-BP 1mg
    EUR 195

    EFNB1 cloning plasmid

    CSB-CL007465HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1041
    • Sequence: atggctcggcctgggcagcgttggctcggcaagtggcttgtggcgatggtcgtgtgggcgctgtgccggctcgccacaccgctggccaagaacctggagcccgtatcctggagctccctcaaccccaagttcctgagtgggaagggcttggtgatctatccgaaaattggagaca
    • Show more
    Description: A cloning plasmid for the EFNB1 gene.

    EFNB1 / 2 Antibody

    abx011999-100ug 100 ug
    EUR 439
    • Shipped within 5-10 working days.

    EFNB1/2 Antibody

    ABF6343 100 ug
    EUR 438

    EFNB1 / EFNB2 Antibody

    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    EFNB1 antibody (Tyr317)

    70R-33574 100 ug
    EUR 327
    Description: Rabbit polyclonal EFNB1 antibody (Tyr317)

    EFNB1 Rabbit pAb

    A14562-100ul 100 ul
    EUR 308