Human HAL(Histidine Ammonia Lyase) ELISA Kit

Human HAL(Histidine Ammonia Lyase) ELISA Kit

To Order Contact us: 

    Human Histidine Ammonia Lyase (HAL) ELISA Kit
    RD-HAL-Hu-48Tests 48 Tests
    EUR 478

    Human Histidine Ammonia Lyase (HAL) ELISA Kit
    RD-HAL-Hu-96Tests 96 Tests
    EUR 662

    Histidine Ammonia-Lyase (HAL) Antibody
    20-abx334175
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Human Histidine Ammonia Lyase (HAL) ELISA Kit
    20-abx156887
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Histidine Ammonia Lyase (HAL) ELISA Kit
    SEH932Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

    Human Histidine Ammonia Lyase (HAL) ELISA Kit
    SEH932Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

    Human Histidine Ammonia Lyase (HAL) ELISA Kit
    SEH932Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

    Human Histidine Ammonia Lyase (HAL) ELISA Kit
    SEH932Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Ammonia Lyase (HAL) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Ammonia Lyase (HAL) in Tissue homogenates, cell lysates and other biological fluids.

    Human Histidine Ammonia Lyase (HAL) ELISA Kit
    4-SEH932Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Histidine Ammonia Lyase elisa. Alternative names of the recognized antigen: HIS
    • Histidase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histidine Ammonia Lyase (HAL) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Rat Histidine Ammonia-Lyase (HAL) ELISA Kit
    abx391456-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Histidine Ammonia-Lyase (HAL) ELISA Kit
    abx389551-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Histidine Ammonia Lyase (HAL) CLIA Kit
    20-abx495586
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Histidine Ammonia-Lyase (HAL) Antibody (HRP)
    20-abx335961
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Histidine Ammonia-Lyase (HAL) Antibody (FITC)
    20-abx335962
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Histidine Ammonia-Lyase (HAL) Antibody (Biotin)
    20-abx335963
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    ELISA kit for Human HAL (Histidine Ammonia Lyase)
    ELK5180 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histidine Ammonia Lyase (HAL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hist
    • Show more
    Description: A sandwich ELISA kit for detection of Histidine Ammonia Lyase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
    ELI-48714h 96 Tests
    EUR 824

    Bovine HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
    ELI-14312b 96 Tests
    EUR 928

    Mouse HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
    ELI-20226m 96 Tests
    EUR 865

    Rat HAL (Histidine ammonia-lyase) ELISA Kit (CUSTOM)
    ELI-38660r 96 Tests
    EUR 886

    Hal ELISA Kit| Rat Histidine ammonia-lyase ELISA Kit
    EF018814 96 Tests
    EUR 689

    Hal ELISA Kit| Mouse Histidine ammonia-lyase ELISA Kit
    EF015185 96 Tests
    EUR 689

    HAL ELISA Kit| Bovine Histidine ammonia-lyase ELISA Kit
    EF011495 96 Tests
    EUR 689

    Human L Phenylalanine ammonia lyase ELISA kit
    E01P0597-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human L Phenylalanine ammonia lyase ELISA kit
    E01P0597-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human L Phenylalanine ammonia lyase ELISA kit
    E01P0597-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Phenylalanine ammonia-lyase Assay Kit
    abx097984-100Assays 100 Assays
    EUR 535
    • Shipped within 5-10 working days.

    Rat L Phenylalanine ammonia lyase ELISA kit
    E02P0597-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat L Phenylalanine ammonia lyase ELISA kit
    E02P0597-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat L Phenylalanine ammonia lyase ELISA kit
    E02P0597-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit L Phenylalanine ammonia lyase ELISA kit
    E04P0597-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit L Phenylalanine ammonia lyase ELISA kit
    E04P0597-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit L Phenylalanine ammonia lyase ELISA kit
    E04P0597-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse L Phenylalanine ammonia lyase ELISA kit
    E03P0597-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse L Phenylalanine ammonia lyase ELISA kit
    E03P0597-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse L Phenylalanine ammonia lyase ELISA kit
    E03P0597-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog L Phenylalanine ammonia lyase ELISA kit
    E08P0597-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog L Phenylalanine ammonia lyase ELISA kit
    E08P0597-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog L Phenylalanine ammonia lyase ELISA kit
    E08P0597-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat L Phenylalanine ammonia lyase ELISA kit
    E06P0597-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat L Phenylalanine ammonia lyase ELISA kit
    E06P0597-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat L Phenylalanine ammonia lyase ELISA kit
    E06P0597-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig L Phenylalanine ammonia lyase ELISA kit
    E07P0597-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig L Phenylalanine ammonia lyase ELISA kit
    E07P0597-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig L Phenylalanine ammonia lyase ELISA kit
    E07P0597-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey L Phenylalanine ammonia lyase ELISA kit
    E09P0597-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey L Phenylalanine ammonia lyase ELISA kit
    E09P0597-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey L Phenylalanine ammonia lyase ELISA kit
    E09P0597-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig L Phenylalanine ammonia lyase ELISA kit
    E05P0597-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig L Phenylalanine ammonia lyase ELISA kit
    E05P0597-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig L Phenylalanine ammonia lyase ELISA kit
    E05P0597-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig L Phenylalanine ammonia lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse L-Phenylalanine ammonia-lyase (PAL) ELISA Kit
    abx350370-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Ethanolamine ammonia-lyase light chain Antibody
    20-abx110555
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    L-Phenylalanine Ammonia-Lyase (pal) Antibody
    20-abx300213
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Ethanolamine ammonia-lyase light chain Antibody (Biotin)
    20-abx106284
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Ethanolamine ammonia-lyase light chain Antibody (FITC)
    20-abx107698
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Ethanolamine ammonia-lyase light chain Antibody (HRP)
    20-abx109116
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    L-Phenylalanine Ammonia-Lyase (pal) Antibody (HRP)
    20-abx300214
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    L-Phenylalanine Ammonia-Lyase (pal) Antibody (FITC)
    20-abx300215
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    L-Phenylalanine Ammonia-Lyase (pal) Antibody (Biotin)
    20-abx300216
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    HAL ELISA KIT|Human
    EF010056 96 Tests
    EUR 689

    Escherichia coli Ethanolamine ammonia-lyase light chain (eutC)
    1-CSB-EP323953ENV
    • EUR 611.00
    • EUR 309.00
    • EUR 1827.00
    • EUR 939.00
    • EUR 1218.00
    • EUR 397.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 35.8 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Escherichia coli Ethanolamine ammonia-lyase light chain(eutC) expressed in E.coli

    HAL ELISA Kit (Human) (OKCD01977)
    OKCD01977 96 Wells
    EUR 831
    Description: Description of target: Histidine ammonia-lyase is a cytosolic enzyme catalyzing the first reaction in histidine catabolism, the nonoxidative deamination of L-histidine to trans-urocanic acid. Histidine ammonia-lyase defects cause histidinemia which is characterized by increased histidine and histamine and decreased urocanic acid in body fluids. Several transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

    Ammonia Assay Kit
    55R-1388 100 assays
    EUR 740
    Description: Assay Kit for detection of Ammonia in the research laboratory

    Ammonia Assay Kit
    55R-1410 100 assays
    EUR 740
    Description: Assay Kit for detection of Ammonia in the research laboratory

    Ammonia Assay Kit
    MET-5086 100 assays
    EUR 456

    Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-100ug
    QP8927-ec-100ug 100ug
    EUR 707

    Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-10ug
    QP8927-ec-10ug 10ug
    EUR 326

    Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-1mg
    QP8927-ec-1mg 1mg
    EUR 2303

    Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-200ug
    QP8927-ec-200ug 200ug
    EUR 1115

    Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-500ug
    QP8927-ec-500ug 500ug
    EUR 1514

    Recombinant E.coli Ethanolamine ammonia-lyase light chain Protein, His, E.coli-50ug
    QP8927-ec-50ug 50ug
    EUR 435

    HAL antibody
    70R-1179 100 ug
    EUR 377
    Description: Rabbit polyclonal HAL antibody raised against the C terminal of HAL

    HAL antibody
    70R-2243 50 ug
    EUR 467
    Description: Rabbit polyclonal HAL antibody raised against the N terminal of HAL

    HAL Antibody
    1-CSB-PA010123LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against HAL. Recognizes HAL from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

    HAL siRNA
    20-abx902405
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    HAL siRNA
    20-abx919058
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    HAL siRNA
    20-abx919059
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ammonia electrode
    ISE50B ea
    EUR 454

    TestStrip? Ammonia
    M1091-100
    EUR 294

    TestStrip? Ammonia
    M1091-200
    EUR 436

    TestStrip? Ammonia
    M1091-50
    EUR 207

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202

    QuantiFluo Ammonia Assay Kit
    DNH3-200 200
    EUR 189
    Description: Quantitative determination of ammonia/ammonium concentration by fluorimetry at 360nm/450nm (compatible on handheld fluorimeter catalog# FL360450). Kit size: 200 tests. Detection limit: 12 µM. Shelf life: 6 months. Shipping: RT; storage: -20°C.

    EnzyChrom Ammonia Assay Kit
    ENH3-100 100
    EUR 329
    Description: Quantitative determination of ammonia/ammonium concentration by colorimetric (340nm) or fluorimetric (360nm/450nm) methods. Kit size: 100 tests. Detection limit: 24 µM. Shelf life: 3 months. Shipping: on ice; storage: -20°C.

    Ammonia Colorimetric Assay Kit
    K370-100
    EUR 539

    Human HAL shRNA Plasmid
    20-abx952062
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    HAL Recombinant Protein (Human)
    RP039709 100 ug Ask for price

    Human Histidine Decarboxylase (HDC) ELISA Kit
    DLR-HDC-Hu-48T 48T
    EUR 517
    • Should the Human Histidine Decarboxylase (HDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Decarboxylase (HDC) in samples from serum, plasma or other biological fluids.

    Human Histidine Decarboxylase (HDC) ELISA Kit
    DLR-HDC-Hu-96T 96T
    EUR 673
    • Should the Human Histidine Decarboxylase (HDC) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Decarboxylase (HDC) in samples from serum, plasma or other biological fluids.

    Human L-Histidine Decarboxylase ELISA kit
    E01L0411-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human L-Histidine Decarboxylase ELISA kit
    E01L0411-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human L-Histidine Decarboxylase ELISA kit
    E01L0411-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human 2-oxo-histidine ELISA kit
    E01O0854-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human 2-oxo-histidine ELISA kit
    E01O0854-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human 2-oxo-histidine ELISA kit
    E01O0854-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Histidine Decarboxylase (HDC) ELISA Kit
    20-abx151779
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Histidine decarboxylase, HDC ELISA KIT
    ELI-31927h 96 Tests
    EUR 824

    Human Histidine Decarboxylase(HDC)ELISA Kit
    QY-E00052 96T
    EUR 361

    Human Histidine Decarboxylase ELISA Kit (HDC)
    RK01553 96 Tests
    EUR 521

    Human Histidine Decarboxylase (HDC) ELISA Kit
    RDR-HDC-Hu-48Tests 48 Tests
    EUR 544

    Human Histidine Decarboxylase (HDC) ELISA Kit
    RDR-HDC-Hu-96Tests 96 Tests
    EUR 756

    Human Histidine Decarboxylase (HDC) ELISA Kit
    RD-HDC-Hu-48Tests 48 Tests
    EUR 521

    Human Histidine Decarboxylase (HDC) ELISA Kit
    RD-HDC-Hu-96Tests 96 Tests
    EUR 723

    Human Histidine Decarboxylase (HDC) ELISA Kit
    SEG476Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Histidine Decarboxylase (HDC) ELISA Kit
    SEG476Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Histidine Decarboxylase (HDC) ELISA Kit
    SEG476Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Histidine Decarboxylase (HDC) ELISA Kit
    SEG476Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Decarboxylase (HDC) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Decarboxylase (HDC) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Histidine Decarboxylase (HDC) ELISA Kit
    4-SEG476Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Histidine Decarboxylase elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histidine Decarboxylase (HDC) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human cystathionine-?-lyase,CSE ELISA Kit
    201-12-0725 96 tests
    EUR 440
    • This cystathionine-?-lyase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Cystathionine Gamma Lyase ELISA kit
    E01C0834-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cystathionine Gamma Lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Cystathionine Gamma Lyase ELISA kit
    E01C0834-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cystathionine Gamma Lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Cystathionine Gamma Lyase ELISA kit
    E01C0834-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Cystathionine Gamma Lyase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Adenylosuccinate lyase(ADSL) ELISA kit
    E01A1290-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Adenylosuccinate lyase(ADSL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Adenylosuccinate lyase(ADSL) ELISA kit
    E01A1290-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Adenylosuccinate lyase(ADSL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Adenylosuccinate lyase(ADSL) ELISA kit
    E01A1290-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Adenylosuccinate lyase(ADSL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Argininosuccinate lyase(ASL) ELISA kit
    E01A1722-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Argininosuccinate lyase(ASL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Argininosuccinate lyase(ASL) ELISA kit
    E01A1722-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Argininosuccinate lyase(ASL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Argininosuccinate lyase(ASL) ELISA kit
    E01A1722-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Argininosuccinate lyase(ASL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ELISA kit for Human Lactoylglutathione lyase
    EK3552 96 tests
    EUR 670
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Lactoylglutathione lyase in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human GLO1/ Lactoylglutathione lyase ELISA Kit
    E1017Hu 1 Kit
    EUR 605

    Human ADSL(Adenylosuccinate lyase) ELISA Kit
    EH13944 96T
    EUR 567.6
    • Detection range: 0.313-20 ng/ml
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human Adenylosuccinate lyase, ADSL ELISA KIT
    ELI-14047h 96 Tests
    EUR 824

    Human Adenylosuccinate lyase (ADSL) ELISA Kit
    abx392197-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Argininosuccinate Lyase (ASL) ELISA Kit
    abx385897-96tests 96 tests
    EUR 911
    • Shipped within 20 working days.

    Human Selenocysteine lyase (SCLY) ELISA Kit
    abx383050-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Selenocysteine lyase, SCLY ELISA KIT
    ELI-35813h 96 Tests
    EUR 824

    Human Lactoylglutathione lyase, GLO1 ELISA KIT
    ELI-38046h 96 Tests
    EUR 824

    Human Argininosuccinate lyase, ASL ELISA KIT
    ELI-49142h 96 Tests
    EUR 824

    Human Adenylosuccinate Lyase(ADSL)ELISA Kit
    QY-E00877 96T
    EUR 361

    Human Selenocysteine Lyase(SCLY)ELISA Kit
    QY-E01011 96T
    EUR 361

    Human Argininosuccinate Lyase(ASL)ELISA Kit
    QY-E02745 96T
    EUR 394

    Ammonia Colorimetric Assay Kit II
    K470-100
    EUR 539

    HAL Polyclonal Antibody
    27864-100ul 100ul
    EUR 252

    HAL Polyclonal Antibody
    27864-50ul 50ul
    EUR 187

    HAL Rabbit pAb
    A13021-100ul 100 ul
    EUR 308

    HAL Rabbit pAb
    A13021-200ul 200 ul
    EUR 459

    HAL Rabbit pAb
    A13021-20ul 20 ul
    EUR 183

    HAL Rabbit pAb
    A13021-50ul 50 ul
    EUR 223

    HAL Blocking Peptide
    33R-2249 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HAL antibody, catalog no. 70R-1179

    HAL Blocking Peptide
    33R-4075 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HAL antibody, catalog no. 70R-2243

    Histidase (HAL) Antibody
    abx145990-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Histidase (HAL) Antibody
    abx233750-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    HAL cloning plasmid
    CSB-CL010123HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1974
    • Sequence: ATGCCCAGATACACGGTGCACGTACGTGGGGAATGGCTGGCAGTGCCCTGCCAGGACGCGCAGCTCACTGTGGGCTGGCTGGGCCGGGAGGCCGTGAGGCGCTATATCAAGAATAAGCCCGACAATGGTGGCTTCACCTCCGTGGATGACGCGCACTTCCTTGTGCGCCGGTGCA
    • Show more
    Description: A cloning plasmid for the HAL gene.

    HAL Polyclonal Antibody
    A69535 100 ?g
    EUR 628.55
    Description: fast delivery possible

    anti- HAL antibody
    FNab03750 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:2000
    • IHC: 1:20-1:200
    • Immunogen: histidine ammonia-lyase
    • Uniprot ID: P42357
    • Gene ID: 3034
    • Research Area: Metabolism
    Description: Antibody raised against HAL

    Anti-HAL antibody
    PAab03750 100 ug
    EUR 386

    Anti-HAL antibody
    STJ114988 100 µl
    EUR 277
    Description: Histidine ammonia-lyase is a cytosolic enzyme catalyzing the first reaction in histidine catabolism, the nonoxidative deamination of L-histidine to trans-urocanic acid. Histidine ammonia-lyase defects cause histidinemia which is characterized by increased histidine and histamine and decreased urocanic acid in body fluids. Several transcript variants encoding different isoforms have been found for this gene.

    Borane Ammonia Complex
    abx188628-500g 500 g
    EUR 1107
    • Shipped within 1-2 weeks.

    calibration solution ammonia
    ISC50 ea
    EUR 91

    Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
    E01C2022-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
    E01C2022-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
    E01C2022-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carbamoyl phosphate synthase [ammonia], mitochondrial(CPS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carbamoyl-phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
    CSB-EL005913HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carbamoyl-phosphate synthase [ammonia], mitochondrial (CPS1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Carbamoyl-phosphate synthase [ammonia], mitochondrial(CPS1) ELISA kit
    1-CSB-EL005913HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carbamoyl-phosphate synthase [ammonia], mitochondrial(CPS1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Carbamoyl-phosphate Synthase [ammonia], Mitochondrial (CPS1) ELISA Kit
    20-abx508456
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    HAL ORF Vector (Human) (pORF)
    ORF013237 1.0 ug DNA
    EUR 354

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    DLR-HRG-Hu-48T 48T
    EUR 517
    • Should the Human Histidine Rich Glycoprotein (HRG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Rich Glycoprotein (HRG) in samples from serum, plasma or other biological fluids.

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    DLR-HRG-Hu-96T 96T
    EUR 673
    • Should the Human Histidine Rich Glycoprotein (HRG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Histidine Rich Glycoprotein (HRG) in samples from serum, plasma or other biological fluids.

    Human Histidine-Rich Glycoprotein, HRG ELISA Kit
    DEIA254 5 plates
    EUR 1361
    Description: The human HRG ELISA kit is for the quantitative determination of human HRG.

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    20-abx151844
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    abx251532-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Human HRG(Histidine-rich glycoprotein) ELISA Kit
    EH2191 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P04196
    • Alias: HRG/HPRG/HRGP/THPH11/Histidine-proline-rich glycoprotein(HPRG)
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    ELISA kit for Human Histidine-rich glycoprotein
    EK4461 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Histidine-rich glycoprotein in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human HRG/ Histidine-rich glycoprotein ELISA Kit
    E1164Hu 1 Kit
    EUR 571

    Human Histidine- rich glycoprotein, HRG ELISA KIT
    ELI-07263h 96 Tests
    EUR 824

    ELISA kit for Human HDC (Histidine Decarboxylase)
    ELK4150 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Histidine Decarboxylase (HDC). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Hist
    • Show more
    Description: A sandwich ELISA kit for detection of Histidine Decarboxylase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human fragile histidine triad (FHIT) ELISA Kit
    CSB-E14182h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human fragile histidine triad (FHIT) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human fragile histidine triad (FHIT) ELISA Kit
    1-CSB-E14182h
    • EUR 900.00
    • EUR 5476.00
    • EUR 2900.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human fragile histidine triad (FHIT) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human histidine-rich glycoprotein (HRG) ELISA kit
    CSB-E13159h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human histidine-rich glycoprotein (HRG) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human histidine-rich glycoprotein (HRG) ELISA kit
    1-CSB-E13159h
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human histidine-rich glycoprotein (HRG) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    abx574921-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Fragile Histidine Triad (FHIT) ELISA Kit
    abx595227-96tests 96 tests
    EUR 637
    • Shipped within 1-2 weeks.

    Human Fragile Histidine Triad (FHIT) ELISA Kit
    abx387358-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human Histidine Rich Glycoprotein(HRG)ELISA Kit
    QY-E00053 96T
    EUR 361

    Human Histidine Rich Glycoprotein ELISA Kit (HRG)
    RK01587 96 Tests
    EUR 521

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    SEC534Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    SEC534Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    SEC534Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    SEC534Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Histidine Rich Glycoprotein (HRG) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Histidine Rich Glycoprotein (HRG) in serum, plasma and other biological fluids.

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    4-SEC534Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Histidine Rich Glycoprotein elisa. Alternative names of the recognized antigen: HPRG
    • HRGP
    • Histidine-Proline Rich Glycoprotein
    • Thrombophilia Due To Elevated HRG
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Histidine Rich Glycoprotein (HRG) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    RDR-HRG-Hu-48Tests 48 Tests
    EUR 544

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    RDR-HRG-Hu-96Tests 96 Tests
    EUR 756

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    RD-HRG-Hu-48Tests 48 Tests
    EUR 521

    Human Histidine Rich Glycoprotein (HRG) ELISA Kit
    RD-HRG-Hu-96Tests 96 Tests
    EUR 723

    Human Cystathionine Gamma Lyase (CSE) ELISA Kit
    DLR-CSE-Hu-48T 48T
    EUR 498
    • Should the Human Cystathionine Gamma Lyase (CSE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Cystathionine Gamma Lyase (CSE) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Cystathionine Gamma Lyase (CSE) ELISA Kit
    DLR-CSE-Hu-96T 96T
    EUR 647
    • Should the Human Cystathionine Gamma Lyase (CSE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Cystathionine Gamma Lyase (CSE) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human N acetylneuraminate lyase(NPL) ELISA kit
    E01N0555-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human N acetylneuraminate lyase(NPL) ELISA kit
    E01N0555-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human N acetylneuraminate lyase(NPL) ELISA kit
    E01N0555-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human N acetylneuraminate lyase(NPL) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human CTH/ Cystathionine gamma-lyase ELISA Kit
    E0590Hu 1 Kit
    EUR 571

    Human Cystathionine gamma Lyase (CSE) ELISA Kit
    20-abx151193
    • EUR 7112.00
    • EUR 3792.00
    • EUR 879.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Cystathionine gamma-lyase (CTH) ELISA Kit
    abx251107-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    ELISA kit for Human Cystathionine gamma-lyase
    EK3769 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human Cystathionine gamma-lyase in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human CTH(Cystathionine gamma-lyase) ELISA Kit
    EH1799 96T
    EUR 567.6
    • Detection range: 0.78-50 ng/ml
    • Uniprot ID: P32929
    • Alias: CTH/Cystathionine gamma-lyase/Gamma-cystathionase
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

    Human N- acetylneuraminate lyase, NPL ELISA KIT
    ELI-21267h 96 Tests
    EUR 824

    Human Cystathionine gamma- lyase, CTH ELISA KIT
    ELI-05064h 96 Tests
    EUR 824

    Human Cystathionine gamma-lyase(CTH) ELISA kit
    CSB-EL006160HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Cystathionine gamma-lyase (CTH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Cystathionine gamma-lyase(CTH) ELISA kit
    1-CSB-EL006160HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Cystathionine gamma-lyase(CTH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human N-acetylneuraminate lyase (NPL) ELISA Kit
    abx381863-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Human cystathionine-γ-lyase(CSE)ELISA Kit
    GA-E0741HM-48T 48T
    EUR 289

    Human cystathionine-γ-lyase(CSE)ELISA Kit
    GA-E0741HM-96T 96T
    EUR 466

    Human cystathionine-γ-lyase(CSE)ELISA Kit
    QY-E00985 96T
    EUR 361

    Human Cystathionine Gamma Lyase ELISA Kit (CSE)
    RK01192 96 Tests
    EUR 521

    Human Cystathionine Gamma Lyase (CSE) ELISA Kit
    RDR-CSE-Hu-48Tests 48 Tests
    EUR 522

    Human Cystathionine Gamma Lyase (CSE) ELISA Kit
    RDR-CSE-Hu-96Tests 96 Tests
    EUR 724

    Human Cystathionine Gamma Lyase (CSE) ELISA Kit
    SEB538Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4502.43
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<1
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

    Human Cystathionine Gamma Lyase (CSE) ELISA Kit
    SEB538Hu-1x48wellstestplate 1x48-wells test plate
    EUR 458.44
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<1
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

    Human Cystathionine Gamma Lyase (CSE) ELISA Kit
    SEB538Hu-1x96wellstestplate 1x96-wells test plate
    EUR 612.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<1
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

    Human Cystathionine Gamma Lyase (CSE) ELISA Kit
    SEB538Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2454.23
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Cystathionine Gamma Lyase (CSE) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<1
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Cystathionine Gamma Lyase (CSE) in tissue homogenates, cell lysates and other biological fluids.

    Human Cystathionine Gamma Lyase (CSE) ELISA Kit
    4-SEB538Hu
    • EUR 4553.00
    • EUR 2405.00
    • EUR 613.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Cystathionine Gamma Lyase elisa. Alternative names of the recognized antigen: CTH
    • Cystathionase
    • Cysteine-protein sulfhydrase
    • Gamma-cystathionase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Cystathionine Gamma Lyase (CSE) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Cystathionine Gamma Lyase (CSE) ELISA Kit
    RD-CSE-Hu-48Tests 48 Tests
    EUR 500

    Human Cystathionine Gamma Lyase (CSE) ELISA Kit
    RD-CSE-Hu-96Tests 96 Tests
    EUR 692

    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Rat 2-oxo-histidine ELISA kit
    E02O0854-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat 2-oxo-histidine ELISA kit
    E02O0854-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat 2-oxo-histidine ELISA kit
    E02O0854-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat L-Histidine Decarboxylase ELISA kit
    E02L0411-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat L-Histidine Decarboxylase ELISA kit
    E02L0411-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat L-Histidine Decarboxylase ELISA kit
    E02L0411-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit 2-oxo-histidine ELISA kit
    E04O0854-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit 2-oxo-histidine ELISA kit
    E04O0854-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit 2-oxo-histidine ELISA kit
    E04O0854-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit L-Histidine Decarboxylase ELISA kit
    E04L0411-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit L-Histidine Decarboxylase ELISA kit
    E04L0411-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit L-Histidine Decarboxylase ELISA kit
    E04L0411-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse 2-oxo-histidine ELISA kit
    E03O0854-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse 2-oxo-histidine ELISA kit
    E03O0854-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse 2-oxo-histidine ELISA kit
    E03O0854-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse L-Histidine Decarboxylase ELISA kit
    E03L0411-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse L-Histidine Decarboxylase ELISA kit
    E03L0411-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse L-Histidine Decarboxylase ELISA kit
    E03L0411-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog 2-oxo-histidine ELISA kit
    E08O0854-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog 2-oxo-histidine ELISA kit
    E08O0854-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog 2-oxo-histidine ELISA kit
    E08O0854-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat L-Histidine Decarboxylase ELISA kit
    E06L0411-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat L-Histidine Decarboxylase ELISA kit
    E06L0411-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat L-Histidine Decarboxylase ELISA kit
    E06L0411-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog L-Histidine Decarboxylase ELISA kit
    E08L0411-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog L-Histidine Decarboxylase ELISA kit
    E08L0411-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog L-Histidine Decarboxylase ELISA kit
    E08L0411-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig L-Histidine Decarboxylase ELISA kit
    E07L0411-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig L-Histidine Decarboxylase ELISA kit
    E07L0411-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig L-Histidine Decarboxylase ELISA kit
    E07L0411-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat 2-oxo-histidine ELISA kit
    E06O0854-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat 2-oxo-histidine ELISA kit
    E06O0854-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat 2-oxo-histidine ELISA kit
    E06O0854-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig 2-oxo-histidine ELISA kit
    E07O0854-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig 2-oxo-histidine ELISA kit
    E07O0854-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig 2-oxo-histidine ELISA kit
    E07O0854-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey L-Histidine Decarboxylase ELISA kit
    E09L0411-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey L-Histidine Decarboxylase ELISA kit
    E09L0411-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey L-Histidine Decarboxylase ELISA kit
    E09L0411-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey L-Histidine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey 2-oxo-histidine ELISA kit
    E09O0854-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey 2-oxo-histidine ELISA kit
    E09O0854-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey 2-oxo-histidine ELISA kit
    E09O0854-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey 2-oxo-histidine in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Histidine decarboxylase, Hdc ELISA KIT
    ELI-26287m 96 Tests
    EUR 865

    for Hexa Histidine (H6)ELISA kit
    CEX656Ge-10x96wellstestplate 10x96-wells test plate
    EUR 5464.54
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Hexa Histidine (H6) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of for Hexa Histidine (H6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    for Hexa Histidine (H6)ELISA kit
    CEX656Ge-1x48wellstestplate 1x48-wells test plate
    EUR 537.67
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Hexa Histidine (H6) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of for Hexa Histidine (H6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    for Hexa Histidine (H6)ELISA kit
    CEX656Ge-1x96wellstestplate 1x96-wells test plate
    EUR 725.24
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Hexa Histidine (H6) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of for Hexa Histidine (H6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    for Hexa Histidine (H6)ELISA kit
    CEX656Ge-5x96wellstestplate 5x96-wells test plate
    EUR 2963.58
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Hexa Histidine (H6) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Competitive Enzyme-linked immunosorbent assay for detection of for Hexa Histidine (H6) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    ELISA Kit for Hexa Histidine (H6)
    4-CEX656Ge
    • EUR 5515.00
    • EUR 2914.00
    • EUR 726.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Hexa Histidine elisa. Alternative names of the recognized antigen: 6xHis
    • His-Tag
    Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Hexa Histidine (H6) in samples from Serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.