Human CPN2(Carboxypeptidase N2) ELISA Kit

Human CPN2(Carboxypeptidase N2) ELISA Kit

To Order Contact us: 

    Human Carboxypeptidase N2 (CPN2)ELISA Kit
    201-12-2437 96 tests
    EUR 440
    • This Carboxypeptidase N2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Carboxypeptidase N2(CPN2)ELISA Kit
    QY-E01341 96T
    EUR 361

    Human Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

    Human Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

    Human Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

    Human Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

    Human Carboxypeptidase N2 (CPN2) ELISA Kit
    4-SEF324Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Carboxypeptidase N2 elisa. Alternative names of the recognized antigen: ACBP
    • Carboxypeptidase N 83 kDa chain
    • Carboxypeptidase N large subunit
    • Carboxypeptidase N regulatory subunit
    • Carboxypeptidase N polypeptide 2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase N2 (CPN2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Carboxypeptidase N2 (CPN2) Antibody
    20-abx129010
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Carboxypeptidase N2 (CPN2) Antibody
    abx027272-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Carboxypeptidase N2 (CPN2) Antibody
    abx027272-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Carboxypeptidase N2 (CPN2) Antibody
    20-abx014322
    • EUR 314.00
    • EUR 98.00
    • EUR 398.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 200 ug
    • 300 µg
    • Shipped within 5-10 working days.

    Carboxypeptidase N2 (CPN2) Antibody
    20-abx175702
    • EUR 1302.00
    • EUR 620.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Carboxypeptidase N2 (CPN2) Antibody
    20-abx323544
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Carboxypeptidase N2 (CPN2) Antibody
    abx330718-100ul 100 ul
    EUR 425
    • Shipped within 5-10 working days.

    Carboxypeptidase N2 (CPN2) Antibody
    20-abx171569
    • EUR 913.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Recombinant Carboxypeptidase N2 (CPN2)
    4-RPF324Hu01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P22792
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 36.3kDa
    • Isoelectric Point: 6.6
    Description: Recombinant Human Carboxypeptidase N2 expressed in: E.coli

    Rat Carboxypeptidase N2(CPN2)ELISA Kit
    GA-E0867RT-48T 48T
    EUR 317

    Rat Carboxypeptidase N2(CPN2)ELISA Kit
    GA-E0867RT-96T 96T
    EUR 496

    Rat Carboxypeptidase N2 (CPN2) ELISA Kit
    20-abx155298
    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Rat Carboxypeptidase N2(CPN2)ELISA Kit
    QY-E10016 96T
    EUR 361

    Rat Carboxypeptidase N2(CPN2)ELISA Kit
    QY-E10785 96T
    EUR 361

    Mouse Carboxypeptidase N2(CPN2)ELISA Kit
    QY-E20261 96T
    EUR 361

    Mouse Carboxypeptidase N2(CPN2)ELISA Kit
    QY-E20262 96T
    EUR 361

    Rat Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Ra-10x96wellstestplate 10x96-wells test plate
    EUR 5124.2
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

    Rat Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Ra-1x48wellstestplate 1x48-wells test plate
    EUR 509.64
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

    Rat Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Ra-1x96wellstestplate 1x96-wells test plate
    EUR 685.2
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

    Rat Carboxypeptidase N2 (CPN2) ELISA Kit
    SEF324Ra-5x96wellstestplate 5x96-wells test plate
    EUR 2783.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxypeptidase N2 (CPN2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxypeptidase N2 (CPN2) in serum, plasma, tissue homogenates and other biological fluids.

    Rat Carboxypeptidase N2 (CPN2) ELISA Kit
    4-SEF324Ra
    • EUR 5175.00
    • EUR 2734.00
    • EUR 686.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Carboxypeptidase N2 elisa. Alternative names of the recognized antigen: ACBP
    • Carboxypeptidase N 83 kDa chain
    • Carboxypeptidase N large subunit
    • Carboxypeptidase N regulatory subunit
    • Carboxypeptidase N polypeptide 2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Carboxypeptidase N2 (CPN2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Human Carboxypeptidase N2 (CPN2) Protein
    20-abx168138
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Carboxypeptidase N2 (CPN2) CLIA Kit
    20-abx494865
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human CPN2 (Carboxypeptidase N2)
    ELK5042 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxypeptidase N2 (CPN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxy
    • Show more
    Description: A sandwich ELISA kit for detection of Carboxypeptidase N2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Rat Carboxypeptidase N2 (CPN2) Protein
    20-abx652777
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Rat Carboxypeptidase N2 (CPN2) CLIA Kit
    20-abx494866
    • EUR 8569.00
    • EUR 4560.00
    • EUR 1052.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Rat CPN2 (Carboxypeptidase N2)
    ELK6729 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxypeptidase N2 (CPN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxy
    • Show more
    Description: A sandwich ELISA kit for detection of Carboxypeptidase N2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human)
    4-PAF324Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPN2 (Gln249~Ala540)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2)

    Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), APC
    4-PAF324Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPN2 (Gln249~Ala540)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with APC.

    Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), Biotinylated
    4-PAF324Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPN2 (Gln249~Ala540)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with Biotin.

    Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), Cy3
    4-PAF324Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPN2 (Gln249~Ala540)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with Cy3.

    Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), FITC
    4-PAF324Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPN2 (Gln249~Ala540)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with FITC.

    Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), HRP
    4-PAF324Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPN2 (Gln249~Ala540)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with HRP.

    Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), PE
    4-PAF324Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPN2 (Gln249~Ala540)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with PE.

    Carboxypeptidase N2 (CPN2) Polyclonal Antibody (Human), APC-Cy7
    4-PAF324Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPN2 (Gln249~Ala540)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Carboxypeptidase N2 (CPN2). This antibody is labeled with APC-Cy7.

    Carboxypeptidase N2 antibody
    70R-49584 100 ul
    EUR 244
    Description: Purified Polyclonal Carboxypeptidase N2 antibody

    Carboxypeptidase N2 antibody
    70R-3276 50 ug
    EUR 467
    Description: Rabbit polyclonal Carboxypeptidase N2 antibody raised against the N terminal of CPN2

    Carboxypeptidase N2 Blocking Peptide
    33R-3103 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CPN2 antibody, catalog no. 70R-3276

    Human Carboxypeptidase N Subunit 2 (CPN2) ELISA Kit
    abx512707-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human CPN2/ Carboxypeptidase N subunit 2 ELISA Kit
    E0548Hu 1 Kit
    EUR 571

    Human Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E01C2009-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E01C2009-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E01C2009-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase N subunit 2(CPN2) ELISA kit
    CSB-EL005899HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase N subunit 2 (CPN2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Carboxypeptidase N subunit 2(CPN2) ELISA kit
    1-CSB-EL005899HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase N subunit 2(CPN2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Carboxypeptidase N 2 (CPN2) Antibody
    20-abx009403
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Mouse Carboxypeptidase N Subunit 2 (CPN2) ELISA Kit
    abx512708-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E06C2009-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E06C2009-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E06C2009-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E02C2009-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E02C2009-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E02C2009-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E03C2009-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E03C2009-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E03C2009-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E04C2009-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E04C2009-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E04C2009-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E07C2009-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E07C2009-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E07C2009-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E08C2009-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E08C2009-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E08C2009-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E09C2009-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E09C2009-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E09C2009-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E05C2009-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E05C2009-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Carboxypeptidase N subunit 2(CPN2) ELISA kit
    E05C2009-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxypeptidase N subunit 2(CPN2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    CPN2 ELISA KIT|Human
    EF007457 96 Tests
    EUR 689

    CPN2 ELISA Kit (Human) (OKCD00699)
    OKCD00699 96 Wells
    EUR 831
    Description: Description of target: The 83 kDa subunit binds and stabilizes the catalytic subunit at 37 degrees Celsius and keeps it in circulation. Under some circumstances it may be an allosteric modifier of the catalytic subunit. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

    CPN2 ELISA Kit (Human) (OKEH06913)
    OKEH06913 96 Wells
    EUR 662
    Description: Description of target: The 83 kDa subunit binds and stabilizes the catalytic subunit at 37 degrees Celsius and keeps it in circulation. Under some circumstances it may be an allosteric modifier of the catalytic subunit. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.78U/L

    N2,N2-Dimethylguanosine
    HY-113137 5mg
    EUR 187

    CPN2 ELISA Kit (Rat) (OKCD08772)
    OKCD08772 96 Wells
    EUR 1053
    Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

    Human Protein Kinase N2(PKN2)ELISA Kit
    QY-E03859 96T
    EUR 361

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202

    CPN2 siRNA
    20-abx912672
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    CPN2 siRNA
    20-abx912673
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    CPN2 antibody
    70R-37038 100 ug
    EUR 327
    Description: Rabbit Polyclonal CPN2 antibody

    CPN2 Antibody
    ABD3901 100 ug
    EUR 438

    CPN2 Antibody
    34551-100ul 100ul
    EUR 252

    CPN2 Antibody
    34551-50ul 50ul
    EUR 187

    CPN2 Antibody
    DF3901 200ul
    EUR 304
    Description: CPN2 Antibody detects endogenous levels of total CPN2.

    CPN2 Antibody
    1-CSB-PA007245
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

    CPN2 Antibody
    CSB-PA276934-
    EUR 335
    • Form: liquid
    • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
    • Show more
    Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

    CPN2 Antibody
    CSB-PA276934-100ul 100ul
    EUR 316
    • Form: liquid
    • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
    • Show more
    Description: A polyclonal antibody against CPN2. Recognizes CPN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

    N2-Methylguanosine
    HY-111647 10mg
    EUR 337

    pEGFP- N2
    PVT1203 2 ug
    EUR 241

    Bacopaside N2
    TBW00873 5mg Ask for price

    Human Carboxypeptidase B1 ELISA kit
    E01C0730-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase B1 ELISA kit
    E01C0730-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase B1 ELISA kit
    E01C0730-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase B1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Carboxypeptidase A1 ELISA KIT|Human
    EF008381 96 Tests
    EUR 689

    Carboxypeptidase A2 ELISA KIT|Human
    EF008382 96 Tests
    EUR 689

    Carboxypeptidase A3 ELISA KIT|Human
    EF008383 96 Tests
    EUR 689

    Carboxypeptidase A5 ELISA KIT|Human
    EF008384 96 Tests
    EUR 689

    Carboxypeptidase A6 ELISA KIT|Human
    EF008385 96 Tests
    EUR 689

    Human CPN2 shRNA Plasmid
    20-abx950959
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    CPN2 Recombinant Protein (Human)
    RP038263 100 ug Ask for price

    Human Forkhead box protein N2, FOXN2 ELISA KIT
    ELI-27523h 96 Tests
    EUR 824

    CPN2 Conjugated Antibody
    C34551 100ul
    EUR 397

    CPN2 cloning plasmid
    CSB-CL005899HU-10ug 10ug
    EUR 569
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1638
    • Sequence: ATGCTCCCTGGAGCCTGGCTGCTCTGGACCTCCCTCCTGCTCCTGGCCAGGCCTGCCCAGCCCTGTCCCATGGGTTGTGACTGCTTCGTCCAGGAGGTGTTCTGCTCAGATGAGGAGCTTGCCACCGTCCCGCTGGACATCCCGCCATATACGAAAAACATCATCTTTGTGGAGA
    • Show more
    Description: A cloning plasmid for the CPN2 gene.

    Anti-CPN2 Antibody
    A05815 100ul
    EUR 397
    Description: Rabbit Polyclonal CPN2 Antibody. Validated in WB and tested in Human.

    CPN2 Blocking Peptide
    DF3901-BP 1mg
    EUR 195

    pCMV-SPORT6-CPN2
    PVT14455 2 ug
    EUR 495

    Rat Protein Kinase N2(PKN2)ELISA Kit
    QY-E10166 96T
    EUR 361

    Mouse Protein Kinase N2(PKN2)ELISA Kit
    QY-E21278 96T
    EUR 361

    Human Carboxypeptidase A2 (CPA2) ELISA Kit
    abx512714-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Carboxypeptidase B2 (CPB2) ELISA Kit
    abx573782-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Human Carboxypeptidase M (CPM) ELISA Kit
    abx576436-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human CPA2/ Carboxypeptidase A2 ELISA Kit
    E0543Hu 1 Kit
    EUR 571

    Human CPB2/ Carboxypeptidase B2 ELISA Kit
    E0545Hu 1 Kit
    EUR 571

    Human CPM/ Carboxypeptidase M ELISA Kit
    E0547Hu 1 Kit
    EUR 571

    Human Probable carboxypeptidase (PM20D1) ELISA kit
    E01P0720-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Probable carboxypeptidase (PM20D1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Probable carboxypeptidase (PM20D1) ELISA kit
    E01P0720-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Probable carboxypeptidase (PM20D1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Probable carboxypeptidase (PM20D1) ELISA kit
    E01P0720-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Probable carboxypeptidase (PM20D1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A1(CPA1) ELISA kit
    E01C1990-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A1(CPA1) ELISA kit
    E01C1990-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A1(CPA1) ELISA kit
    E01C1990-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A1(CPA1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A2(CPA2) ELISA kit
    E01C1991-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A2(CPA2) ELISA kit
    E01C1991-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A2(CPA2) ELISA kit
    E01C1991-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A2(CPA2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A4(CPA4) ELISA kit
    E01C1992-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A4(CPA4) ELISA kit
    E01C1992-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A4(CPA4) ELISA kit
    E01C1992-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A4(CPA4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A5(CPA5) ELISA kit
    E01C1993-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A5(CPA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A5(CPA5) ELISA kit
    E01C1993-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A5(CPA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A5(CPA5) ELISA kit
    E01C1993-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A5(CPA5) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A6(CPA6) ELISA kit
    E01C1994-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A6(CPA6) ELISA kit
    E01C1994-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase A6(CPA6) ELISA kit
    E01C1994-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase A6(CPA6) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase D(CPD) ELISA kit
    E01C1996-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase D(CPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase D(CPD) ELISA kit
    E01C1996-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase D(CPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase D(CPD) ELISA kit
    E01C1996-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase D(CPD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase E(CPE) ELISA kit
    E01C1997-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase E(CPE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase E(CPE) ELISA kit
    E01C1997-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase E(CPE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase E(CPE) ELISA kit
    E01C1997-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase E(CPE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase M(CPM) ELISA kit
    E01C2006-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase M(CPM) ELISA kit
    E01C2006-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase M(CPM) ELISA kit
    E01C2006-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase M(CPM) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase O(CPO) ELISA kit
    E01C2019-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase O(CPO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase O(CPO) ELISA kit
    E01C2019-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase O(CPO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase O(CPO) ELISA kit
    E01C2019-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase O(CPO) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase Z(CPZ) ELISA kit
    E01C2032-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase Z(CPZ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase Z(CPZ) ELISA kit
    E01C2032-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase Z(CPZ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Carboxypeptidase Z(CPZ) ELISA kit
    E01C2032-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Carboxypeptidase Z(CPZ) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human CPB1(Carboxypeptidase B1) ELISA Kit
    EH4304 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Alias: Carboxypeptidase B1
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human CPB2(Carboxypeptidase B2) ELISA Kit
    EH0980 96T
    EUR 567.6
    • Detection range: 3.12-200 ng/ml
    • Uniprot ID: Q96IY4
    • Alias: CPB2(Carboxypeptidase B2)/CPU/TAFI/carboxypeptidase B2/Carboxypeptidase U/PCPB/Plasma carboxypeptidase B/carboxypeptidase B-like protein/Thrombin-activable fibrinolysis inhibitor
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 1.875 ng/ml

    Human CPM(Carboxypeptidase M) ELISA Kit
    EH1622 96T
    EUR 567.6
    • Detection range: 1.56-100 ng/ml
    • Uniprot ID: P14384
    • Alias: CPM/Carboxypeptidase M
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

    Human CPE(Carboxypeptidase E) ELISA Kit
    EH2877 96T
    EUR 524.1
    • Detection range: 0.625-40 ng/ml
    • Uniprot ID: P16870
    • Alias: CPE/Carboxypeptidase H/Convertase
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

    Human Carboxypeptidase A5, CPA5 ELISA KIT
    ELI-10756h 96 Tests
    EUR 824

    Human Carboxypeptidase O, CPO ELISA KIT
    ELI-10896h 96 Tests
    EUR 824

    Human Carboxypeptidase D, CPD ELISA KIT
    ELI-11233h 96 Tests
    EUR 824

    Human Carboxypeptidase Z, CPZ ELISA KIT
    ELI-11234h 96 Tests
    EUR 824

    Human Carboxypeptidase A1, CPA1 ELISA KIT
    ELI-23863h 96 Tests
    EUR 824

    Human Carboxypeptidase A6, CPA6 ELISA KIT
    ELI-25531h 96 Tests
    EUR 824

    Human Carboxypeptidase B2, CPB2 ELISA KIT
    ELI-02200h 96 Tests
    EUR 824

    Human Carboxypeptidase M, CPM ELISA KIT
    ELI-04766h 96 Tests
    EUR 824

    Human Carboxypeptidase B, CPB1 ELISA KIT
    ELI-33947h 96 Tests
    EUR 824

    Human Carboxypeptidase A4, CPA4 ELISA KIT
    ELI-49172h 96 Tests
    EUR 824

    Human Carboxypeptidase E, CPE ELISA KIT
    ELI-50203h 96 Tests
    EUR 824

    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    20-abx150933
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Carboxypeptidase E (CPE) ELISA Kit
    20-abx150934
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Carboxypeptidase M (CPM) ELISA Kit
    20-abx150935
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    20-abx150936
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Carboxypeptidase Z (CPZ) ELISA Kit
    20-abx150937
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Carboxypeptidase B2 (CPB2) ELISA Kit
    abx054753-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Human Carboxypeptidase B1 (CPB1) ELISA Kit
    abx055595-96tests 96 tests
    EUR 668
    • Shipped within 5-10 working days.

    Human Carboxypeptidase A1 (CPA1) ELISA Kit
    20-abx386289
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.

    Human Carboxypeptidase A5 (CPA5) ELISA Kit
    20-abx386291
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.

    Human Carboxypeptidase A6 (CPA6) ELISA Kit
    20-abx386292
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.

    Human Carboxypeptidase B1 (CPB1) ELISA Kit
    abx257718-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.

    Human Carboxypeptidase B1 (CPB1) ELISA Kit
    abx257754-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.

    Human Carboxypeptidase E (CPE) ELISA Kit
    abx252265-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Carboxypeptidase B2 (CPB2) ELISA Kit
    abx253935-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Human Carboxypeptidase N1 (CPN1)ELISA Kit
    201-12-2436 96 tests
    EUR 440
    • This Carboxypeptidase N1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    DLR-CPA4-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase A4 (CPA4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase A4 (CPA4) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    DLR-CPA4-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase A4 (CPA4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase A4 (CPA4) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Carboxypeptidase E (CPE) ELISA Kit
    DLR-CPE-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase E (CPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase E (CPE) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Carboxypeptidase E (CPE) ELISA Kit
    DLR-CPE-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase E (CPE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase E (CPE) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Carboxypeptidase M (CPM) ELISA Kit
    DLR-CPM-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase M (CPM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase M (CPM) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Carboxypeptidase M (CPM) ELISA Kit
    DLR-CPM-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase M (CPM) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase M (CPM) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    DLR-CPN1-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase N1 (CPN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase N1 (CPN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    DLR-CPN1-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase N1 (CPN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase N1 (CPN1) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Carboxypeptidase Z (CPZ) ELISA Kit
    DLR-CPZ-Hu-48T 48T
    EUR 517
    • Should the Human Carboxypeptidase Z (CPZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase Z (CPZ) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Human Carboxypeptidase Z (CPZ) ELISA Kit
    DLR-CPZ-Hu-96T 96T
    EUR 673
    • Should the Human Carboxypeptidase Z (CPZ) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxypeptidase Z (CPZ) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Human Mast Cell Carboxypeptidase ELISA Kit
    CSB-E13756h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Mast Cell Carboxypeptidase in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Mast Cell Carboxypeptidase ELISA Kit
    1-CSB-E13756h
    • EUR 900.00
    • EUR 5476.00
    • EUR 2900.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Mast Cell Carboxypeptidase in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Carboxypeptidase B(CPB1) ELISA kit
    CSB-EL005883HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase B (CPB1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Carboxypeptidase B(CPB1) ELISA kit
    1-CSB-EL005883HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase B(CPB1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Carboxypeptidase E(CPE) ELISA kit
    CSB-EL005886HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase E (CPE) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Carboxypeptidase E(CPE) ELISA kit
    1-CSB-EL005886HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Carboxypeptidase E(CPE) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Carboxypeptidase M (CPM) ELISA Kit
    SEC397Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase M (CPM) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase M (CPM) in serum, plasma, tissue homogenates and other biological fluids.

    Human Carboxypeptidase M (CPM) ELISA Kit
    SEC397Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase M (CPM) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase M (CPM) in serum, plasma, tissue homogenates and other biological fluids.

    Human Carboxypeptidase M (CPM) ELISA Kit
    SEC397Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase M (CPM) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase M (CPM) in serum, plasma, tissue homogenates and other biological fluids.

    Human Carboxypeptidase M (CPM) ELISA Kit
    SEC397Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxypeptidase M (CPM) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxypeptidase M (CPM) in serum, plasma, tissue homogenates and other biological fluids.

    Human Carboxypeptidase M (CPM) ELISA Kit
    4-SEC397Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Carboxypeptidase M elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxypeptidase M (CPM) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Carboxypeptidase E ELISA Kit (CPE)
    RK01173 96 Tests
    EUR 521

    Human Carboxypeptidase N1 ELISA Kit (CPN1)
    RK01175 96 Tests
    EUR 521

    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    RDR-CPA4-Hu-48Tests 48 Tests
    EUR 544

    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    RDR-CPA4-Hu-96Tests 96 Tests
    EUR 756

    Human Carboxypeptidase E (CPE) ELISA Kit
    RDR-CPE-Hu-48Tests 48 Tests
    EUR 544

    Human Carboxypeptidase E (CPE) ELISA Kit
    RDR-CPE-Hu-96Tests 96 Tests
    EUR 756

    Human Carboxypeptidase M (CPM) ELISA Kit
    RDR-CPM-Hu-48Tests 48 Tests
    EUR 544

    Human Carboxypeptidase M (CPM) ELISA Kit
    RDR-CPM-Hu-96Tests 96 Tests
    EUR 756

    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    RDR-CPN1-Hu-48Tests 48 Tests
    EUR 544

    Human Carboxypeptidase N1 (CPN1) ELISA Kit
    RDR-CPN1-Hu-96Tests 96 Tests
    EUR 756

    Human Carboxypeptidase Z (CPZ) ELISA Kit
    RDR-CPZ-Hu-48Tests 48 Tests
    EUR 544

    Human Carboxypeptidase Z (CPZ) ELISA Kit
    RDR-CPZ-Hu-96Tests 96 Tests
    EUR 756

    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    RD-CPA4-Hu-48Tests 48 Tests
    EUR 521

    Human Carboxypeptidase A4 (CPA4) ELISA Kit
    RD-CPA4-Hu-96Tests 96 Tests
    EUR 723

    Human Carboxypeptidase E (CPE) ELISA Kit
    RD-CPE-Hu-48Tests 48 Tests
    EUR 521

    Human Carboxypeptidase E (CPE) ELISA Kit
    RD-CPE-Hu-96Tests 96 Tests
    EUR 723