Human SGCd(Sarcoglycan Delta) ELISA Kit

Human SGCd(Sarcoglycan Delta) ELISA Kit

To Order Contact us: 

    Human Sarcoglycan Delta (SGCd) ELISA Kit
    RD-SGCd-Hu-96Tests 96 Tests
    EUR 723
    Human Sarcoglycan Delta (SGCd) ELISA Kit
    RDR-SGCd-Hu-48Tests 48 Tests
    EUR 544
    Human Sarcoglycan Delta (SGCd) ELISA Kit
    RDR-SGCd-Hu-96Tests 96 Tests
    EUR 756
    Human Sarcoglycan delta (SGCd) ELISA Kit
    20-abx153016
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Delta- sarcoglycan, SGCD ELISA KIT
    ELI-36009h 96 Tests
    EUR 824
    Human Sarcoglycan Delta(SGCd)ELISA Kit
    QY-E03015 96T
    EUR 400
    Human Sarcoglycan Delta (SGCd) ELISA Kit
    SEE226Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.
    Human Sarcoglycan Delta (SGCd) ELISA Kit
    SEE226Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.
    Human Sarcoglycan Delta (SGCd) ELISA Kit
    SEE226Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.
    Human Sarcoglycan Delta (SGCd) ELISA Kit
    SEE226Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.
    Human Sarcoglycan Delta (SGCd) ELISA Kit
    4-SEE226Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Sarcoglycan Delta elisa. Alternative names of the recognized antigen: 35DAG
    • CMD1L
    • DAGD
    • SG-delta
    • SGCDP
    • SGD
    • 35kDa Dystrophin-Associated Glycoprotein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sarcoglycan Delta (SGCd) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Sarcoglycan Delta (SGCD) Antibody
    20-abx005293
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Sarcoglycan Delta (SGCd) Antibody
    20-abx130531
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Sarcoglycan Delta (SGCd) Antibody
    20-abx174456
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Sarcoglycan Delta (SGCD) Protein
    20-abx261024
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    Sarcoglycan Delta (SGCD) Antibody
    20-abx322415
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Recombinant Sarcoglycan Delta (SGCd)
    4-RPE226Hu01
    • EUR 494.24
    • EUR 235.00
    • EUR 1578.40
    • EUR 592.80
    • EUR 1085.60
    • EUR 394.00
    • EUR 3796.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q92629
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 28.4kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Sarcoglycan Delta expressed in: E.coli
    Mouse Delta- sarcoglycan, Sgcd ELISA KIT
    ELI-18647m 96 Tests
    EUR 865
    Human Sarcoglycan Delta (SGCd) Protein
    20-abx650584
    • EUR 690.00
    • EUR 286.00
    • EUR 2124.00
    • EUR 815.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Human Sarcoglycan delta (SGCd) CLIA Kit
    20-abx494548
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    ELISA kit for Human SGCd (Sarcoglycan Delta)
    ELK4751 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcoglycan Delta (SGC?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcoglyc
    • Show more
    Description: A sandwich ELISA kit for detection of Sarcoglycan Delta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Delta-sarcoglycan (SGCD)
    KTE60672-48T 48T
    EUR 332
    • Delta-sarcoglycan isone of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). The sarcoglycans are a family of transmembrane proteins involved in the protein complex responsible f
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Delta-sarcoglycan (SGCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Delta-sarcoglycan (SGCD)
    KTE60672-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Delta-sarcoglycan isone of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). The sarcoglycans are a family of transmembrane proteins involved in the protein complex responsible f
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Delta-sarcoglycan (SGCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Delta-sarcoglycan (SGCD)
    KTE60672-96T 96T
    EUR 539
    • Delta-sarcoglycan isone of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). The sarcoglycans are a family of transmembrane proteins involved in the protein complex responsible f
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Delta-sarcoglycan (SGCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human)
    4-PAE226Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SGCd (Ile63~Leu289)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd)
    SGCD Sarcoglycan Delta Human Recombinant Protein
    PROTQ92629 Regular: 20ug
    EUR 317
    Description: SGCD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 257 amino acids (57-289a.a) and having a molecular mass of 28kDa. SGCD is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
    Polyclonal SGCD / Delta-Sarcoglycan Antibody (Internal)
    APG01191G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SGCD / Delta-Sarcoglycan (Internal). This antibody is tested and proven to work in the following applications:
    Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), APC
    4-PAE226Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SGCd (Ile63~Leu289)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with APC.
    Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), Biotinylated
    4-PAE226Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SGCd (Ile63~Leu289)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with Biotin.
    Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), Cy3
    4-PAE226Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SGCd (Ile63~Leu289)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with Cy3.
    Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), FITC
    4-PAE226Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SGCd (Ile63~Leu289)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with FITC.
    Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), HRP
    4-PAE226Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SGCd (Ile63~Leu289)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with HRP.
    Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), PE
    4-PAE226Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SGCd (Ile63~Leu289)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with PE.
    Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), APC-Cy7
    4-PAE226Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: SGCd (Ile63~Leu289)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with APC-Cy7.
    delta Sarcoglycan Antibody
    49501-100ul 100ul
    EUR 333
    delta Sarcoglycan Antibody
    49501-50ul 50ul
    EUR 239
    Sarcoglycan delta Antibody
    20-abx137486
    • EUR 704.00
    • EUR 328.00
    • EUR 230.00
    • 100 ug
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    delta-Sarcoglycan Antibody
    20-abx142221
    • EUR 370.00
    • EUR 606.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Delta-Sarcoglycan Antibody
    abx431803-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    anti-delta Sarcoglycan
    YF-PA14616 50 ug
    EUR 363
    Description: Mouse polyclonal to delta Sarcoglycan
    anti-delta Sarcoglycan
    YF-PA14617 100 ul
    EUR 403
    Description: Rabbit polyclonal to delta Sarcoglycan
    anti-delta Sarcoglycan
    YF-PA14618 100 ug
    EUR 403
    Description: Rabbit polyclonal to delta Sarcoglycan
    delta Sarcoglycan Conjugated Antibody
    C49501 100ul
    EUR 397
    Delta-Sarcoglycan Antibody (Biotin)
    abx431804-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    Anti-delta Sarcoglycan Rabbit Monoclonal Antibody
    M05297 100ug/vial
    EUR 397
    Description: Rabbit Monoclonal delta Sarcoglycan Antibody. Validated in IP, WB and tested in Human.
    Anti-Delta-Sarcoglycan (aa245-257) antibody
    STJ72512 100 µg
    EUR 359
    SGCD ELISA Kit (Human) (OKCD01259)
    OKCD01259 96 Wells
    EUR 831
    Description: Description of target: Component of the sarcoglycan complex, a subcomplex of the dystrophin-glycoprotein complex which forms a link between the F-actin cytoskeleton and the extracellular matrix. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.28 ng/mL
    Anti-Delta-Sarcoglycan (aa245-257), Biotinylated antibody
    STJ73241 100 µg
    EUR 359
    Alpha-sarcoglycan ELISA KIT|Human
    EF007731 96 Tests
    EUR 689
    Beta sarcoglycan ELISA KIT|Human
    EF008107 96 Tests
    EUR 689
    Polyclonal Delta-Sarcoglycan (aa245-257) Antibody (internal region)
    APR15718G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Delta-Sarcoglycan (aa245-257) (internal region). This antibody is tested and proven to work in the following applications:
    Human β sarcoglycan(SGCB) ELISA kit
    E01B0966-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human β sarcoglycan(SGCB) ELISA kit
    E01B0966-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human β sarcoglycan(SGCB) ELISA kit
    E01B0966-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Alpha sarcoglycan(SGCA) ELISA kit
    E01A1973-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Alpha sarcoglycan(SGCA) ELISA kit
    E01A1973-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Alpha sarcoglycan(SGCA) ELISA kit
    E01A1973-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Beta-Sarcoglycan (SGCB) ELISA Kit
    20-abx259434
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.
    Human Gamma- sarcoglycan, SGCG ELISA KIT
    ELI-15568h 96 Tests
    EUR 824
    Human Zeta- sarcoglycan, SGCZ ELISA KIT
    ELI-52469h 96 Tests
    EUR 824
    Human Sarcoglycan Alpha (SGCA) ELISA Kit
    20-abx385720
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.
    Human Sarcoglycan Epsilon (SGCE) ELISA Kit
    abx383152-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Sarcoglycan Gamma (SGCG) ELISA Kit
    abx383153-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Human Beta- sarcoglycan, SGCB ELISA KIT
    ELI-39348h 96 Tests
    EUR 824
    Human Alpha- sarcoglycan, SGCA ELISA KIT
    ELI-40829h 96 Tests
    EUR 824
    Human Epsilon- sarcoglycan, SGCE ELISA KIT
    ELI-40830h 96 Tests
    EUR 824
    Human Sarcoglycan Zeta(SGCz)ELISA Kit
    QY-E03013 96T
    EUR 400
    Human Sarcoglycan Epsilon(SGCe)ELISA Kit
    QY-E03014 96T
    EUR 400
    Human Sarcoglycan Gamma(SGCg)ELISA Kit
    QY-E03016 96T
    EUR 400
    Human Sarcoglycan Beta(SGCb)ELISA Kit
    QY-E03017 96T
    EUR 400
    Sarcoglycan-
    ABD8605 100 ug
    EUR 438
    Beta Sarcoglycan (beta sarcoglycan) Antibody
    20-abx008721
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Beta Sarcoglycan (Beta sarcoglycan) Antibody
    abx230878-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    SGCD Antibody
    47201-100ul 100ul
    EUR 252
    SGCD antibody
    10R-10249 50 ul
    EUR 219
    Description: Mouse monoclonal SGCD antibody
    SGCD Antibody
    1-CSB-PA835688ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against SGCD. Recognizes SGCD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
    SGCD siRNA
    20-abx933150
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    SGCD siRNA
    20-abx933151
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Human SGCD shRNA Plasmid
    20-abx954355
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    SGCD Recombinant Protein (Human)
    RP028375 100 ug Ask for price
    Mouse Alpha sarcoglycan(SGCA) ELISA kit
    E03A1973-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Alpha sarcoglycan(SGCA) ELISA kit
    E03A1973-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Alpha sarcoglycan(SGCA) ELISA kit
    E03A1973-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse β sarcoglycan(SGCB) ELISA kit
    E03B0966-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse β sarcoglycan(SGCB) ELISA kit
    E03B0966-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse β sarcoglycan(SGCB) ELISA kit
    E03B0966-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Alpha sarcoglycan(SGCA) ELISA kit
    E06A1973-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Alpha sarcoglycan(SGCA) ELISA kit
    E06A1973-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Alpha sarcoglycan(SGCA) ELISA kit
    E06A1973-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat β sarcoglycan(SGCB) ELISA kit
    E06B0966-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat β sarcoglycan(SGCB) ELISA kit
    E06B0966-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat β sarcoglycan(SGCB) ELISA kit
    E06B0966-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Alpha sarcoglycan(SGCA) ELISA kit
    E04A1973-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Alpha sarcoglycan(SGCA) ELISA kit
    E04A1973-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Alpha sarcoglycan(SGCA) ELISA kit
    E04A1973-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit β sarcoglycan(SGCB) ELISA kit
    E04B0966-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit β sarcoglycan(SGCB) ELISA kit
    E04B0966-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit β sarcoglycan(SGCB) ELISA kit
    E04B0966-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat β sarcoglycan(SGCB) ELISA kit
    E02B0966-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat β sarcoglycan(SGCB) ELISA kit
    E02B0966-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat β sarcoglycan(SGCB) ELISA kit
    E02B0966-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Alpha sarcoglycan(SGCA) ELISA kit
    E02A1973-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Alpha sarcoglycan(SGCA) ELISA kit
    E02A1973-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Alpha sarcoglycan(SGCA) ELISA kit
    E02A1973-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Alpha sarcoglycan(SGCA) ELISA kit
    E07A1973-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Alpha sarcoglycan(SGCA) ELISA kit
    E07A1973-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Alpha sarcoglycan(SGCA) ELISA kit
    E07A1973-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey β sarcoglycan(SGCB) ELISA kit
    E09B0966-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey β sarcoglycan(SGCB) ELISA kit
    E09B0966-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey β sarcoglycan(SGCB) ELISA kit
    E09B0966-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Alpha sarcoglycan(SGCA) ELISA kit
    E08A1973-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Alpha sarcoglycan(SGCA) ELISA kit
    E08A1973-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Alpha sarcoglycan(SGCA) ELISA kit
    E08A1973-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog β sarcoglycan(SGCB) ELISA kit
    E08B0966-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog β sarcoglycan(SGCB) ELISA kit
    E08B0966-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog β sarcoglycan(SGCB) ELISA kit
    E08B0966-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig β sarcoglycan(SGCB) ELISA kit
    E07B0966-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig β sarcoglycan(SGCB) ELISA kit
    E07B0966-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig β sarcoglycan(SGCB) ELISA kit
    E07B0966-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Alpha sarcoglycan(SGCA) ELISA kit
    E09A1973-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Alpha sarcoglycan(SGCA) ELISA kit
    E09A1973-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Alpha sarcoglycan(SGCA) ELISA kit
    E09A1973-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Gamma- sarcoglycan, Sgcg ELISA KIT
    ELI-13511m 96 Tests
    EUR 865
    Bovine Epsilon- sarcoglycan, SGCE ELISA KIT
    ELI-13567b 96 Tests
    EUR 928
    Mouse Alpha- sarcoglycan, Sgca ELISA KIT
    ELI-15567m 96 Tests
    EUR 865
    Bovine Beta- sarcoglycan, SGCB ELISA KIT
    ELI-19202b 96 Tests
    EUR 928
    Mouse Zeta- sarcoglycan, Sgcz ELISA KIT
    ELI-29721m 96 Tests
    EUR 865
    Bovine Gamma- sarcoglycan, SGCG ELISA KIT
    ELI-30378b 96 Tests
    EUR 928
    Rabbit Alpha- sarcoglycan, SGCA ELISA KIT
    ELI-52957Ra 96 Tests
    EUR 928
    Mouse Epsilon- sarcoglycan, Sgce ELISA KIT
    ELI-52958m 96 Tests
    EUR 865
    Mouse Beta- sarcoglycan, Sgcb ELISA KIT
    ELI-53251m 96 Tests
    EUR 865
    Rabbit Beta- sarcoglycan, SGCB ELISA KIT
    ELI-41571Ra 96 Tests
    EUR 928
    SGCD Rabbit pAb
    A13351-100ul 100 ul
    EUR 308
    SGCD Rabbit pAb
    A13351-200ul 200 ul
    EUR 459
    SGCD Rabbit pAb
    A13351-20ul 20 ul
    EUR 183
    SGCD Rabbit pAb
    A13351-50ul 50 ul
    EUR 223
    SGCD Conjugated Antibody
    C47201 100ul
    EUR 397
    SGCD cloning plasmid
    CSB-CL835688HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 873
    • Sequence: atgatgcctcaggagcagtacactcaccaccggagcaccatgcctggctctgtggggccacaggtatacaaggtggggatttacggctggcggaaacgatgcctgtatttctttgtcctgctcctcatgattttaatactggtgaacttggccatgaccatctggattctcaaagt
    • Show more
    Description: A cloning plasmid for the SGCD gene.
    SGCD Rabbit pAb
    A6980-100ul 100 ul
    EUR 308
    SGCD Rabbit pAb
    A6980-200ul 200 ul
    EUR 459
    SGCD Rabbit pAb
    A6980-20ul 20 ul
    EUR 183
    SGCD Rabbit pAb
    A6980-50ul 50 ul
    EUR 223
    SGCD Polyclonal Antibody
    ABP60383-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human SGCD protein
    • Applications tips:
    Description: A polyclonal antibody for detection of SGCD from Human, Mouse. This SGCD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGCD protein
    SGCD Polyclonal Antibody
    ABP60383-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human SGCD protein
    • Applications tips:
    Description: A polyclonal antibody for detection of SGCD from Human, Mouse. This SGCD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGCD protein
    SGCD Polyclonal Antibody
    ABP60383-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human SGCD protein
    • Applications tips:
    Description: A polyclonal antibody for detection of SGCD from Human, Mouse. This SGCD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGCD protein
    SGCD Polyclonal Antibody
    ES11141-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against SGCD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    SGCD Polyclonal Antibody
    ES11141-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against SGCD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    Anti-SGCD antibody
    STJ29060 100 µl
    EUR 277
    Description: The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene.
    Anti-SGCD antibody
    STJ115314 100 µl
    EUR 277
    Description: The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene.
    Anti-SGCD antibody
    STJ192299 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to SGCD
    CaMKII delta ELISA KIT|Human
    EF008361 96 Tests
    EUR 689
    SGCD ORF Vector (Human) (pORF)
    ORF009459 1.0 ug DNA
    EUR 95
    Guinea pig β sarcoglycan(SGCB) ELISA kit
    E05B0966-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig β sarcoglycan(SGCB) ELISA kit
    E05B0966-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig β sarcoglycan(SGCB) ELISA kit
    E05B0966-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Alpha sarcoglycan(SGCA) ELISA kit
    E05A1973-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Alpha sarcoglycan(SGCA) ELISA kit
    E05A1973-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Alpha sarcoglycan(SGCA) ELISA kit
    E05A1973-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    gamma Sarcoglycan Antibody
    49536-100ul 100ul
    EUR 333
    gamma Sarcoglycan Antibody
    49536-50ul 50ul
    EUR 239
    alpha sarcoglycan Antibody
    49537-100ul 100ul
    EUR 333
    alpha sarcoglycan Antibody
    49537-50ul 50ul
    EUR 239
    Sarcoglycan-β Antibody
    45387-100ul 100ul
    EUR 252
    Sarcoglycan-β Antibody
    45387-50ul 50ul
    EUR 187
    Sarcoglycan beta Antibody
    DF8605 200ul
    EUR 304
    Description: Sarcoglycan-β Antibody detects endogenous levels of total Sarcoglycan-β.
    Alpha sarcoglycan antibody
    70R-50381 100 ul
    EUR 244
    Description: Purified Polyclonal Alpha sarcoglycan antibody
    Beta sarcoglycan antibody
    70R-50382 100 ul
    EUR 244
    Description: Purified Polyclonal Beta sarcoglycan antibody
    alpha sarcoglycan Antibody
    20-abx008722
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.
    Sarcoglycan- beta Antibody
    20-abx218551
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.