Human SGCd(Sarcoglycan Delta) ELISA Kit

Human SGCd(Sarcoglycan Delta) ELISA Kit

To Order Contact us: 

Human Sarcoglycan Delta (SGCd) ELISA Kit
RD-SGCd-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Sarcoglycan Delta (SGCd) ELISA Kit
RDR-SGCd-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Sarcoglycan Delta (SGCd) ELISA Kit
RDR-SGCd-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Sarcoglycan delta (SGCd) ELISA Kit
20-abx153016	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Delta- sarcoglycan, SGCD ELISA KIT
ELI-36009h	Lifescience Market	96 Tests	EUR 824

Human Sarcoglycan Delta(SGCd)ELISA Kit
QY-E03015	Qayee Biotechnology	96T	EUR 400

Human Sarcoglycan Delta (SGCd) ELISA Kit
SEE226Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.

Human Sarcoglycan Delta (SGCd) ELISA Kit
SEE226Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.

Human Sarcoglycan Delta (SGCd) ELISA Kit
SEE226Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.

Human Sarcoglycan Delta (SGCd) ELISA Kit
SEE226Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sarcoglycan Delta (SGCd) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sarcoglycan Delta (SGCd) in Tissue homogenates and other biological fluids.

Human Sarcoglycan Delta (SGCd) ELISA Kit
4-SEE226Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Sarcoglycan Delta elisa. Alternative names of the recognized antigen: 35DAG CMD1L DAGD SG-delta SGCDP SGD 35kDa Dystrophin-Associated Glycoprotein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sarcoglycan Delta (SGCd) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Sarcoglycan Delta (SGCD) Antibody
20-abx005293	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Sarcoglycan Delta (SGCd) Antibody
20-abx130531	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Sarcoglycan Delta (SGCd) Antibody
20-abx174456	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Sarcoglycan Delta (SGCD) Protein
20-abx261024	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Sarcoglycan Delta (SGCD) Antibody
20-abx322415	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Sarcoglycan Delta (SGCd)
4-RPE226Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q92629 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 28.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Sarcoglycan Delta expressed in: E.coli

Mouse Delta- sarcoglycan, Sgcd ELISA KIT
ELI-18647m	Lifescience Market	96 Tests	EUR 865

Human Sarcoglycan Delta (SGCd) Protein
20-abx650584	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Sarcoglycan delta (SGCd) CLIA Kit
20-abx494548	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human SGCd (Sarcoglycan Delta)
ELK4751	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sarcoglycan Delta (SGC?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sarcoglyc Show more
Description: A sandwich ELISA kit for detection of Sarcoglycan Delta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Delta-sarcoglycan (SGCD)
KTE60672-48T	Abbkine	48T	EUR 332
Delta-sarcoglycan isone of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). The sarcoglycans are a family of transmembrane proteins involved in the protein complex responsible f Show more
Description: Quantitative sandwich ELISA for measuring Human Delta-sarcoglycan (SGCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Delta-sarcoglycan (SGCD)
KTE60672-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Delta-sarcoglycan isone of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). The sarcoglycans are a family of transmembrane proteins involved in the protein complex responsible f Show more
Description: Quantitative sandwich ELISA for measuring Human Delta-sarcoglycan (SGCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Delta-sarcoglycan (SGCD)
KTE60672-96T	Abbkine	96T	EUR 539
Delta-sarcoglycan isone of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). The sarcoglycans are a family of transmembrane proteins involved in the protein complex responsible f Show more
Description: Quantitative sandwich ELISA for measuring Human Delta-sarcoglycan (SGCD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human)
4-PAE226Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGCd (Ile63~Leu289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd)

SGCD Sarcoglycan Delta Human Recombinant Protein
PROTQ92629	BosterBio	Regular: 20ug	EUR 317
Description: SGCD Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 257 amino acids (57-289a.a) and having a molecular mass of 28kDa. SGCD is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Polyclonal SGCD / Delta-Sarcoglycan Antibody (Internal)
APG01191G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human SGCD / Delta-Sarcoglycan (Internal). This antibody is tested and proven to work in the following applications:

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), APC
4-PAE226Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGCd (Ile63~Leu289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with APC.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), Biotinylated
4-PAE226Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGCd (Ile63~Leu289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with Biotin.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), Cy3
4-PAE226Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGCd (Ile63~Leu289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with Cy3.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), FITC
4-PAE226Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGCd (Ile63~Leu289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with FITC.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), HRP
4-PAE226Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGCd (Ile63~Leu289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with HRP.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), PE
4-PAE226Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGCd (Ile63~Leu289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with PE.

Sarcoglycan Delta (SGCd) Polyclonal Antibody (Human), APC-Cy7
4-PAE226Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: SGCd (Ile63~Leu289) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sarcoglycan Delta (SGCd). This antibody is labeled with APC-Cy7.

delta Sarcoglycan Antibody
49501-100ul	SAB	100ul	EUR 333

delta Sarcoglycan Antibody
49501-50ul	SAB	50ul	EUR 239

Sarcoglycan delta Antibody
20-abx137486	Abbexa	EUR 704.00 EUR 328.00 EUR 230.00	100 ug 20 ug 5 ug
Shipped within 5-10 working days.

delta-Sarcoglycan Antibody
20-abx142221	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Delta-Sarcoglycan Antibody
abx431803-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

anti-delta Sarcoglycan
YF-PA14616	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to delta Sarcoglycan

anti-delta Sarcoglycan
YF-PA14617	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to delta Sarcoglycan

anti-delta Sarcoglycan
YF-PA14618	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to delta Sarcoglycan

delta Sarcoglycan Conjugated Antibody
C49501	SAB	100ul	EUR 397

Delta-Sarcoglycan Antibody (Biotin)
abx431804-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Anti-delta Sarcoglycan Rabbit Monoclonal Antibody
M05297	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal delta Sarcoglycan Antibody. Validated in IP, WB and tested in Human.

Anti-Delta-Sarcoglycan (aa245-257) antibody
STJ72512	St John's Laboratory	100 µg	EUR 359

Anti-Delta-Sarcoglycan (aa245-257), Biotinylated antibody
STJ73241	St John's Laboratory	100 µg	EUR 359

Alpha-sarcoglycan ELISA KIT|Human
EF007731	Lifescience Market	96 Tests	EUR 689

Beta sarcoglycan ELISA KIT|Human
EF008107	Lifescience Market	96 Tests	EUR 689

Polyclonal Delta-Sarcoglycan (aa245-257) Antibody (internal region)
APR15718G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Delta-Sarcoglycan (aa245-257) (internal region). This antibody is tested and proven to work in the following applications:

Human β sarcoglycan(SGCB) ELISA kit
E01B0966-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β sarcoglycan(SGCB) ELISA kit
E01B0966-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human β sarcoglycan(SGCB) ELISA kit
E01B0966-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha sarcoglycan(SGCA) ELISA kit
E01A1973-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha sarcoglycan(SGCA) ELISA kit
E01A1973-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Alpha sarcoglycan(SGCA) ELISA kit
E01A1973-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta-Sarcoglycan (SGCB) ELISA Kit
20-abx259434	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Gamma- sarcoglycan, SGCG ELISA KIT
ELI-15568h	Lifescience Market	96 Tests	EUR 824

Human Zeta- sarcoglycan, SGCZ ELISA KIT
ELI-52469h	Lifescience Market	96 Tests	EUR 824

Human Sarcoglycan Alpha (SGCA) ELISA Kit
20-abx385720	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human Sarcoglycan Epsilon (SGCE) ELISA Kit
abx383152-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Sarcoglycan Gamma (SGCG) ELISA Kit
abx383153-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Beta- sarcoglycan, SGCB ELISA KIT
ELI-39348h	Lifescience Market	96 Tests	EUR 824

Human Alpha- sarcoglycan, SGCA ELISA KIT
ELI-40829h	Lifescience Market	96 Tests	EUR 824

Human Epsilon- sarcoglycan, SGCE ELISA KIT
ELI-40830h	Lifescience Market	96 Tests	EUR 824

Human Sarcoglycan Zeta(SGCz)ELISA Kit
QY-E03013	Qayee Biotechnology	96T	EUR 400

Human Sarcoglycan Epsilon(SGCe)ELISA Kit
QY-E03014	Qayee Biotechnology	96T	EUR 400

Human Sarcoglycan Gamma(SGCg)ELISA Kit
QY-E03016	Qayee Biotechnology	96T	EUR 400

Human Sarcoglycan Beta(SGCb)ELISA Kit
QY-E03017	Qayee Biotechnology	96T	EUR 400

Sarcoglycan-
ABD8605	Lifescience Market	100 ug	EUR 438

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Beta Sarcoglycan (beta sarcoglycan) Antibody
20-abx008721	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Beta Sarcoglycan (Beta sarcoglycan) Antibody
abx230878-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

SGCD Antibody
47201-100ul	SAB	100ul	EUR 252

SGCD antibody
10R-10249	Fitzgerald	50 ul	EUR 219
Description: Mouse monoclonal SGCD antibody

SGCD Antibody
1-CSB-PA835688ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against SGCD. Recognizes SGCD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SGCD siRNA
20-abx933150	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SGCD siRNA
20-abx933151	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human SGCD shRNA Plasmid
20-abx954355	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SGCD Recombinant Protein (Human)
RP028375	ABM	100 ug	Ask for price

Mouse Alpha sarcoglycan(SGCA) ELISA kit
E03A1973-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha sarcoglycan(SGCA) ELISA kit
E03A1973-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Alpha sarcoglycan(SGCA) ELISA kit
E03A1973-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β sarcoglycan(SGCB) ELISA kit
E03B0966-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β sarcoglycan(SGCB) ELISA kit
E03B0966-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse β sarcoglycan(SGCB) ELISA kit
E03B0966-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha sarcoglycan(SGCA) ELISA kit
E06A1973-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha sarcoglycan(SGCA) ELISA kit
E06A1973-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Alpha sarcoglycan(SGCA) ELISA kit
E06A1973-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β sarcoglycan(SGCB) ELISA kit
E06B0966-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β sarcoglycan(SGCB) ELISA kit
E06B0966-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat β sarcoglycan(SGCB) ELISA kit
E06B0966-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha sarcoglycan(SGCA) ELISA kit
E04A1973-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha sarcoglycan(SGCA) ELISA kit
E04A1973-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Alpha sarcoglycan(SGCA) ELISA kit
E04A1973-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β sarcoglycan(SGCB) ELISA kit
E04B0966-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β sarcoglycan(SGCB) ELISA kit
E04B0966-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit β sarcoglycan(SGCB) ELISA kit
E04B0966-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β sarcoglycan(SGCB) ELISA kit
E02B0966-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β sarcoglycan(SGCB) ELISA kit
E02B0966-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat β sarcoglycan(SGCB) ELISA kit
E02B0966-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha sarcoglycan(SGCA) ELISA kit
E02A1973-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha sarcoglycan(SGCA) ELISA kit
E02A1973-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Alpha sarcoglycan(SGCA) ELISA kit
E02A1973-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha sarcoglycan(SGCA) ELISA kit
E07A1973-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha sarcoglycan(SGCA) ELISA kit
E07A1973-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Alpha sarcoglycan(SGCA) ELISA kit
E07A1973-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β sarcoglycan(SGCB) ELISA kit
E09B0966-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β sarcoglycan(SGCB) ELISA kit
E09B0966-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey β sarcoglycan(SGCB) ELISA kit
E09B0966-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha sarcoglycan(SGCA) ELISA kit
E08A1973-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha sarcoglycan(SGCA) ELISA kit
E08A1973-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Alpha sarcoglycan(SGCA) ELISA kit
E08A1973-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β sarcoglycan(SGCB) ELISA kit
E08B0966-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β sarcoglycan(SGCB) ELISA kit
E08B0966-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog β sarcoglycan(SGCB) ELISA kit
E08B0966-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β sarcoglycan(SGCB) ELISA kit
E07B0966-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β sarcoglycan(SGCB) ELISA kit
E07B0966-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig β sarcoglycan(SGCB) ELISA kit
E07B0966-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha sarcoglycan(SGCA) ELISA kit
E09A1973-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha sarcoglycan(SGCA) ELISA kit
E09A1973-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Alpha sarcoglycan(SGCA) ELISA kit
E09A1973-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Gamma- sarcoglycan, Sgcg ELISA KIT
ELI-13511m	Lifescience Market	96 Tests	EUR 865

Bovine Epsilon- sarcoglycan, SGCE ELISA KIT
ELI-13567b	Lifescience Market	96 Tests	EUR 928

Mouse Alpha- sarcoglycan, Sgca ELISA KIT
ELI-15567m	Lifescience Market	96 Tests	EUR 865

Bovine Beta- sarcoglycan, SGCB ELISA KIT
ELI-19202b	Lifescience Market	96 Tests	EUR 928

Mouse Zeta- sarcoglycan, Sgcz ELISA KIT
ELI-29721m	Lifescience Market	96 Tests	EUR 865

Bovine Gamma- sarcoglycan, SGCG ELISA KIT
ELI-30378b	Lifescience Market	96 Tests	EUR 928

Rabbit Alpha- sarcoglycan, SGCA ELISA KIT
ELI-52957Ra	Lifescience Market	96 Tests	EUR 928

Mouse Epsilon- sarcoglycan, Sgce ELISA KIT
ELI-52958m	Lifescience Market	96 Tests	EUR 865

Mouse Beta- sarcoglycan, Sgcb ELISA KIT
ELI-53251m	Lifescience Market	96 Tests	EUR 865

Rabbit Beta- sarcoglycan, SGCB ELISA KIT
ELI-41571Ra	Lifescience Market	96 Tests	EUR 928

SGCD Rabbit pAb
A13351-100ul	Abclonal	100 ul	EUR 308

SGCD Rabbit pAb
A13351-200ul	Abclonal	200 ul	EUR 459

SGCD Rabbit pAb
A13351-20ul	Abclonal	20 ul	EUR 183

SGCD Rabbit pAb
A13351-50ul	Abclonal	50 ul	EUR 223

SGCD Conjugated Antibody
C47201	SAB	100ul	EUR 397

SGCD cloning plasmid
CSB-CL835688HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 873 Sequence: atgatgcctcaggagcagtacactcaccaccggagcaccatgcctggctctgtggggccacaggtatacaaggtggggatttacggctggcggaaacgatgcctgtatttctttgtcctgctcctcatgattttaatactggtgaacttggccatgaccatctggattctcaaagt Show more
Description: A cloning plasmid for the SGCD gene.

SGCD Rabbit pAb
A6980-100ul	Abclonal	100 ul	EUR 308

SGCD Rabbit pAb
A6980-200ul	Abclonal	200 ul	EUR 459

SGCD Rabbit pAb
A6980-20ul	Abclonal	20 ul	EUR 183

SGCD Rabbit pAb
A6980-50ul	Abclonal	50 ul	EUR 223

SGCD Polyclonal Antibody
ABP60383-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human SGCD protein Applications tips:
Description: A polyclonal antibody for detection of SGCD from Human, Mouse. This SGCD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGCD protein

SGCD Polyclonal Antibody
ABP60383-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human SGCD protein Applications tips:
Description: A polyclonal antibody for detection of SGCD from Human, Mouse. This SGCD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGCD protein

SGCD Polyclonal Antibody
ABP60383-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human SGCD protein Applications tips:
Description: A polyclonal antibody for detection of SGCD from Human, Mouse. This SGCD antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SGCD protein

SGCD Polyclonal Antibody
ES11141-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against SGCD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

SGCD Polyclonal Antibody
ES11141-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against SGCD from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-SGCD antibody
STJ29060	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene.

Anti-SGCD antibody
STJ115314	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is one of the four known components of the sarcoglycan complex, which is a subcomplex of the dystrophin-glycoprotein complex (DGC). DGC forms a link between the F-actin cytoskeleton and the extracellular matrix. This protein is expressed most abundantly in skeletal and cardiac muscle. Mutations in this gene have been associated with autosomal recessive limb-girdle muscular dystrophy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding distinct isoforms have been observed for this gene.

Anti-SGCD antibody
STJ192299	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SGCD

CaMKII delta ELISA KIT|Human
EF008361	Lifescience Market	96 Tests	EUR 689

Guinea pig β sarcoglycan(SGCB) ELISA kit
E05B0966-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β sarcoglycan(SGCB) ELISA kit
E05B0966-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig β sarcoglycan(SGCB) ELISA kit
E05B0966-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig β sarcoglycan(SGCB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alpha sarcoglycan(SGCA) ELISA kit
E05A1973-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alpha sarcoglycan(SGCA) ELISA kit
E05A1973-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Alpha sarcoglycan(SGCA) ELISA kit
E05A1973-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Alpha sarcoglycan(SGCA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SGCD ORF Vector (Human) (pORF)
ORF009459	ABM	1.0 ug DNA	EUR 95

gamma Sarcoglycan Antibody
49536-100ul	SAB	100ul	EUR 333

gamma Sarcoglycan Antibody
49536-50ul	SAB	50ul	EUR 239

alpha sarcoglycan Antibody
49537-100ul	SAB	100ul	EUR 333

alpha sarcoglycan Antibody
49537-50ul	SAB	50ul	EUR 239

Sarcoglycan-β Antibody
45387-100ul	SAB	100ul	EUR 252

Sarcoglycan-β Antibody
45387-50ul	SAB	50ul	EUR 187

Sarcoglycan beta Antibody
DF8605	Affbiotech	200ul	EUR 304
Description: Sarcoglycan-β Antibody detects endogenous levels of total Sarcoglycan-β.

Alpha sarcoglycan antibody
70R-50381	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal Alpha sarcoglycan antibody

Beta sarcoglycan antibody
70R-50382	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal Beta sarcoglycan antibody

alpha sarcoglycan Antibody
20-abx008722	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Sarcoglycan- beta Antibody
20-abx218551	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Epsilon-sarcoglycan Antibody
20-abx141728	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.