Human CHIT1(Chitinase 1) ELISA Kit

Human CHIT1(Chitinase 1) ELISA Kit

To Order Contact us: 

Mouse Chitinase 1 (CHIT1) ELISA Kit

RDR-CHIT1-Mu-96Tests 96 Tests
EUR 774

Mouse Chitinase 1 (CHIT1) ELISA Kit

RD-CHIT1-Mu-48Tests 48 Tests
EUR 533

Mouse Chitinase 1 (CHIT1) ELISA Kit

RD-CHIT1-Mu-96Tests 96 Tests
EUR 740

Human Chitinase 1 (CHIT1) ELISA Kit

20-abx151052
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Chitinase 1 (CHIT1) ELISA Kit

abx250839-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Chitinase 1 (CHIT1) ELISA Kit

abx516697-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Chitinase 1(CHIT1)ELISA Kit

QY-E02939 96T
EUR 400

Human Chitinase 1 ELISA Kit (CHIT1)

RK01109 96 Tests
EUR 521

Human Chitinase 1 (CHIT1) ELISA Kit

SEJ374Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Chitinase 1 (CHIT1) ELISA Kit

SEJ374Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Chitinase 1 (CHIT1) ELISA Kit

SEJ374Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Chitinase 1 (CHIT1) ELISA Kit

SEJ374Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Chitinase 1 (CHIT1) ELISA Kit

4-SEJ374Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Chitinase 1 elisa. Alternative names of the recognized antigen: CHI3
  • Chitotriosidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Chitinase 1 (CHIT1) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Chitinase 1 (CHIT1) ELISA Kit

20-abx153818
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Chitinase 1 (CHIT1) ELISA Kit

abx570991-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Chitinase 1 ELISA Kit (CHIT1)

RK02685 96 Tests
EUR 521

Mouse Chitinase 1 (CHIT1) ELISA Kit

SEJ374Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Chitinase 1 (CHIT1) ELISA Kit

SEJ374Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Chitinase 1 (CHIT1) ELISA Kit

SEJ374Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Chitinase 1 (CHIT1) ELISA Kit

SEJ374Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Chitinase 1 (CHIT1) ELISA Kit

4-SEJ374Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Chitinase 1 elisa. Alternative names of the recognized antigen: CHI3
  • Chitotriosidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Chitinase 1 (CHIT1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E01C1680-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E01C1680-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E01C1680-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human CHIT1 (Chitinase 1)

ELK4932 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chitinase 1 (CHIT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Chitinase 1 (C
  • Show more
Description: A sandwich ELISA kit for detection of Chitinase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human chitinase 1 (chitotriosidase) (CHIT1)ELISA kit

CSB-E17930h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human chitinase 1 (chitotriosidase) (CHIT1) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human chitinase 1 (chitotriosidase) (CHIT1)ELISA kit

1-CSB-E17930h
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human chitinase 1 (chitotriosidase) (CHIT1) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Chitinase 1 (CHIT1) Antibody

20-abx006278
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chitinase 1 (CHIT1) Antibody

abx015729-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Chitinase 1 (CHIT1) Antibody

20-abx175827
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Chitinase 1 (CHIT1) Antibody

20-abx175828
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Chitinase 1 (CHIT1) Antibody

20-abx100901
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chitinase 1 (CHIT1) Antibody

20-abx130881
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chitinase 1 (CHIT1) Antibody

20-abx171702
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Chitinase 1 (CHIT1) Antibody

abx340166-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chitinase 1 (CHIT1) Antibody

abx432499-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Chitinase 1 (CHIT1) Antibody

abx231651-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Chitinase 1 (CHIT1)

4-RPJ374Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q13231
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Chitinase 1 expressed in: E.coli

Recombinant Chitinase 1 (CHIT1)

4-RPJ374Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9D7Q1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Chitinase 1 expressed in: E.coli

Human Chitinase 1 (CHIT1) CLIA Kit

20-abx495703
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Chitinase 1 (CHIT1) Protein

20-abx650761
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E02C1680-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E02C1680-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E02C1680-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E03C1680-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E03C1680-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E03C1680-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E06C1680-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E06C1680-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E06C1680-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E04C1680-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E04C1680-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E04C1680-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E07C1680-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E07C1680-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E07C1680-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E09C1680-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E09C1680-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E09C1680-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E08C1680-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E08C1680-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E08C1680-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse CHIT1 (Chitinase 1)

ELK6315 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chitinase 1 (CHIT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Chitinase 1 (C
  • Show more
Description: A sandwich ELISA kit for detection of Chitinase 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Chitinase 1 (CHIT1) CLIA Kit

20-abx495704
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Chitinase 1 (CHIT1) Antibody (Biotin)

20-abx271840
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Chitinase 1 (CHIT1) Protein

20-abx650762
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human)

4-PAJ374Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Ala193~Asn466)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1)

Guinea pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E05C1680-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E05C1680-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit

E05C1680-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), APC

4-PAJ374Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Ala193~Asn466)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with APC.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), Biotinylated

4-PAJ374Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Ala193~Asn466)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with Biotin.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), Cy3

4-PAJ374Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Ala193~Asn466)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with Cy3.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), FITC

4-PAJ374Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Ala193~Asn466)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with FITC.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), HRP

4-PAJ374Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Ala193~Asn466)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with HRP.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), PE

4-PAJ374Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Ala193~Asn466)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with PE.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse)

4-PAJ374Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Met210~Ser464)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1)

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), APC-Cy7

4-PAJ374Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Ala193~Asn466)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with APC-Cy7.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), APC

4-PAJ374Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Met210~Ser464)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with APC.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), Biotinylated

4-PAJ374Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Met210~Ser464)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with Biotin.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), Cy3

4-PAJ374Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Met210~Ser464)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with Cy3.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), FITC

4-PAJ374Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Met210~Ser464)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with FITC.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), HRP

4-PAJ374Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Met210~Ser464)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with HRP.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), PE

4-PAJ374Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Met210~Ser464)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with PE.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), APC-Cy7

4-PAJ374Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: CHIT1 (Met210~Ser464)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with APC-Cy7.

Human CHIT1 ELISA Kit

ELA-E13980h 96 Tests
EUR 824

CHIT1 ELISA KIT|Human

EF005704 96 Tests
EUR 689

Human CHIT1/ Chitotriosidase-1 ELISA Kit

E0494Hu 1 Kit
EUR 605

Human CHIT1(Chitotriosidase-1) ELISA Kit

EH1551 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q13231
  • Alias: CHIT1/Chitotriosidase-1/Chitinase-1/CHI3/CHIT/plasma methylumbelliferyl tetra-N-acetylchitotetraoside hydrolase/FLJ00314/MGC125322
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Chitotriosidase- 1, CHIT1 ELISA KIT

ELI-25276h 96 Tests
EUR 824

ELISA kit for Human CHIT1 (Chitotriosidase-1)

E-EL-H5620 1 plate of 96 wells
EUR 534
  • Gentaur's CHIT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CHIT1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CHIT1 (Chitotriosidase-1) in samples from Serum, Plasma, Cell supernatant

Human CHIT1 PicoKine ELISA Kit

EK2032 96 wells
EUR 425
Description: For quantitative detection of human CHIT1 in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse Chit1/ Chitotriosidase-1 ELISA Kit

E0290Mo 1 Kit
EUR 632

Mouse Chitotriosidase- 1, Chit1 ELISA KIT

ELI-25479m 96 Tests
EUR 865

Mouse Chitotriosidase-1(CHIT1) ELISA kit

CSB-EL005352MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Chitotriosidase-1 (CHIT1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Chitotriosidase-1(CHIT1) ELISA kit

1-CSB-EL005352MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Chitotriosidase-1(CHIT1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Chit1 ELISA Kit| Mouse Chitotriosidase-1 ELISA Kit

EF014475 96 Tests
EUR 689

Mouse CHIT1 PicoKine ELISA Kit

EK2033 96 wells
EUR 425
Description: For quantitative detection of mouse CHIT1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Chitinase, Acidic (CHIA) ELISA Kit

abx251797-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Chitinase, Acidic(CHIA)ELISA Kit

QY-E01368 96T
EUR 400

Chitinase-IN-1

HY-18598 10mM/1mL
EUR 580

CHI3L1 (22-383) Chitinase 3-Like 1 (22-383 a.a) Human Recombinant Protein

PROTP36222-1 Regular: 5ug
EUR 317
Description: CHI3L1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 370 amino acids (22-383 a.a.) and having a molecular mass of 41.4kDa (Migrates at 40-57kDa on SDS-PAGE under reducing conditions).CHI3L1 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Human CHID1/ Chitinase domain-containing protein 1 ELISA Kit

E0493Hu 1 Kit
EUR 605

Human Chitinase domain containing protein 1(CHID1) ELISA kit

E01C1679-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase domain containing protein 1(CHID1) ELISA kit

E01C1679-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase domain containing protein 1(CHID1) ELISA kit

E01C1679-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase Domain-Containing Protein 1 (CHID1) ELISA Kit

abx251898-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Human Chitinase domain-containing protein 1

EK5060 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Chitinase domain-containing protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CHID1(Chitinase domain-containing protein 1) ELISA Kit

EH2526 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q9BWS9
  • Alias: CHID1/Chitinase domain-containing protein 1/Stabilin-1-interacting chitinase-like protein(SI-CLP)
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

ELISA kit for Human Chitinase-3-like protein 1

EK3439 96 tests
EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Chitinase-3-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CHI3L1/ Chitinase-3-like protein 1 ELISA Kit

E2758Hu 1 Kit
EUR 537

Human CHI3L1(Chitinase-3-like protein 1) ELISA Kit

EH0093 96T
EUR 524.1
  • Detection range: 62.5-4000 pg/ml
  • Uniprot ID: P36222
  • Alias: CHI3L1(Chitinase-3-like protein 1)/GP39/Glycoprotein 39, Cartilage/YKL-40/ASRT7/CGP-39/HC-gp39/YYL-40
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml

Human Chitinase domain- containing protein 1, CHID1 ELISA KIT

ELI-10148h 96 Tests
EUR 824

Human Chitinase- 3- like protein 1, CHI3L1 ELISA KIT

ELI-04790h 96 Tests
EUR 824

Human Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit

abx575447-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Chitinase 3-like 1/YKL-40 ELISA Kit

LF-EK50990 1×96T
EUR 648

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Chitinase Assay Kit

abx298854-100Assays 100 Assays
EUR 582
  • Shipped within 5-10 working days.

CHIT1 antibody

10R-2159 100 ul
EUR 403
Description: Mouse monoclonal CHIT1 antibody

CHIT1 Antibody

46490-100ul 100ul
EUR 252

CHIT1 siRNA

20-abx911702
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CHIT1 siRNA

20-abx911703
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-CHIT1

YF-PA10935 50 ug
EUR 363
Description: Mouse polyclonal to CHIT1

anti-CHIT1

YF-PA10936 100 ug
EUR 403
Description: Rabbit polyclonal to CHIT1

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

CHI3L2 Human, Chitinase 3-Like 2 Human Recombinant Protein, Sf9

PROTQ15782-1 Regular: 10ug
EUR 317
Description: CHI3L2 produced in Sf9 Baculovirus cells is a single,glycosylated polypeptide chain containing 372 amino acids (27-390a.a.) andhaving a molecular mass of 41.9kDa. (Molecular size on SDS-PAGE will appear atapproximately 40-57kDa).CHI3L2 is expressed with an 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques.

Human Acidic mammalian chitinase(CHIA) ELISA kit

E01A1812-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acidic mammalian chitinase(CHIA) ELISA kit

E01A1812-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acidic mammalian chitinase(CHIA) ELISA kit

E01A1812-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CHIA/ Acidic mammalian chitinase ELISA Kit

E0492Hu 1 Kit
EUR 605

ELISA kit for Human Acidic mammalian chitinase

EK4891 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Acidic mammalian chitinase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CHIA(Acidic mammalian chitinase) ELISA Kit

EH2434 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9BZP6
  • Alias: CHIA/Lung-specific protein TSA1902/AMCase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Acidic mammalian chitinase(CHIA) ELISA kit

CSB-EL005348HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acidic mammalian chitinase (CHIA) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Acidic mammalian chitinase(CHIA) ELISA kit

1-CSB-EL005348HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acidic mammalian chitinase(CHIA) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Acidic mammalian chitinase, CHIA ELISA KIT

ELI-50735h 96 Tests
EUR 824

Human CHIT1 shRNA Plasmid

20-abx950798
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Human CHIT1 Protein

RP00248 20 μg
EUR 311

CHIT1 Recombinant Protein (Human)

RP038032 100 ug Ask for price

Human Chitinase 3-like 1/YKL-40 PicoKine ELISA Kit

EK0974 96 wells
EUR 425
Description: For quantitative detection of human Chitinase 3-like 1 in cell culture supernates, serum, plasma(heparin, EDTA) and urine.

Recombinant Human Chitotriosidase-1/CHIT1 (C-6His)

C451-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.

Recombinant Human Chitotriosidase-1/CHIT1 (C-6His)

C451-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.

Recombinant Human Chitotriosidase-1/CHIT1 (C-6His)

C451-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.

Recombinant Human Chitotriosidase-1/CHIT1 (C-6His)

C451-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.

CHIT1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0445202 1.0 ug DNA
EUR 154

Mouse Chitinase, Acidic (CHIA) ELISA Kit

abx255153-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Cow Chitinase, Acidic (CHIA) ELISA Kit

abx520956-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Chitinase, Acidic (CHIA) ELISA Kit

abx520959-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

CHI3L1 ELISA Kit| Bovine Chitinase-3-like protein 1 ELISA Kit

EF011031 96 Tests
EUR 689

Chi3l1 ELISA Kit| Mouse Chitinase-3-like protein 1 ELISA Kit

EF012846 96 Tests
EUR 689

ELISA kit for Mouse CHI3L1 (Chitinase 3-like 1)

E-EL-M0016 1 plate of 96 wells
EUR 534
  • Gentaur's CHI3L1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CHI3L1. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CHI3L1 (Chitinase 3-like 1) in samples from Serum, Plasma, Cell supernatant

Bovine CHI3L1/ Chitinase-3-like protein 1 ELISA Kit

E0066Bo 1 Kit
EUR 717

Rat Chitinase domain containing protein 1(CHID1) ELISA kit

E02C1679-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chitinase domain containing protein 1(CHID1) ELISA kit

E02C1679-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chitinase domain containing protein 1(CHID1) ELISA kit

E02C1679-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chid1/ Chitinase domain-containing protein 1 ELISA Kit

E0203Ra 1 Kit
EUR 646

Mouse Chi3l1/ Chitinase-3-like protein 1 ELISA Kit

E0286Mo 1 Kit
EUR 546

Mouse Chitinase domain containing protein 1(CHID1) ELISA kit

E03C1679-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chitinase domain containing protein 1(CHID1) ELISA kit

E03C1679-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chitinase domain containing protein 1(CHID1) ELISA kit

E03C1679-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chitinase domain containing protein 1(CHID1) ELISA kit

E06C1679-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chitinase domain containing protein 1(CHID1) ELISA kit

E06C1679-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chitinase domain containing protein 1(CHID1) ELISA kit

E06C1679-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chitinase domain containing protein 1(CHID1) ELISA kit

E04C1679-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chitinase domain containing protein 1(CHID1) ELISA kit

E04C1679-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chitinase domain containing protein 1(CHID1) ELISA kit

E04C1679-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chitinase domain containing protein 1(CHID1) ELISA kit

E07C1679-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chitinase domain containing protein 1(CHID1) ELISA kit

E07C1679-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chitinase domain containing protein 1(CHID1) ELISA kit

E07C1679-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit

abx254010-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Cow Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit

abx257794-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Chitinase-3-like protein 1 (Chi3l1) ELISA Kit

abx259339-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Monkey Chitinase domain containing protein 1(CHID1) ELISA kit

E09C1679-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chitinase domain containing protein 1(CHID1) ELISA kit

E09C1679-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chitinase domain containing protein 1(CHID1) ELISA kit

E09C1679-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Bovine Chitinase-3-like protein 1

EK3440 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Chitinase-3-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Dog Chitinase domain containing protein 1(CHID1) ELISA kit

E08C1679-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chitinase domain containing protein 1(CHID1) ELISA kit

E08C1679-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chitinase domain containing protein 1(CHID1) ELISA kit

E08C1679-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine CHI3L1(Chitinase-3-like protein 1) ELISA Kit

EB0079 96T
EUR 567.6
  • Detection range: 1.563-100 ng/ml
  • Alias: Chitinase-3-like protein 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 0.938 ng/ml

Bovine Chitinase domain- containing protein 1, CHID1 ELISA KIT

ELI-25746b 96 Tests
EUR 928

Rat Chitinase- 3- like protein 1, Chi3l1 ELISA KIT

ELI-04788r 96 Tests
EUR 886

Mouse Chitinase- 3- like protein 1, Chi3l1 ELISA KIT

ELI-04789m 96 Tests
EUR 865

Porcine Chitinase- 3- like protein 1, CHI3L1 ELISA KIT

ELI-04791p 96 Tests
EUR 928

Bovine Chitinase- 3- like protein 1, CHI3L1 ELISA KIT

ELI-04792b 96 Tests
EUR 928

Mouse Chitinase-3-like protein 1(CHI3L1) ELISA kit

CSB-EL005346MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Chitinase-3-like protein 1 (CHI3L1) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Chitinase-3-like protein 1(CHI3L1) ELISA kit

1-CSB-EL005346MO
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Chitinase-3-like protein 1(CHI3L1) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig Chitinase-3-like protein 1(CHI3L1) ELISA kit

CSB-EL005346PI-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig Chitinase-3-like protein 1 (CHI3L1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Pig Chitinase-3-like protein 1(CHI3L1) ELISA kit

1-CSB-EL005346PI
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig Chitinase-3-like protein 1(CHI3L1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Chitinase-3-like protein 1(CHI3L1) ELISA kit

CSB-EL005346RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Chitinase-3-like protein 1 (CHI3L1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Chitinase-3-like protein 1(CHI3L1) ELISA kit

1-CSB-EL005346RA
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Chitinase-3-like protein 1(CHI3L1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cow Chitinase Domain-Containing Protein 1 (CHID1) ELISA Kit

abx521378-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Chitinase Domain-Containing Protein 1 (CHID1) ELISA Kit

abx521380-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Chitinase Domain-Containing Protein 1 (CHID1) ELISA Kit

abx521381-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit

abx575321-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit

abx517044-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Pig Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit

abx517045-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Chi3l1( Chitinase-3-like protein 1) ELISA Kit

EM0057 96T
EUR 524.1
  • Detection range: 62.5-4000 pg/ml
  • Uniprot ID: Q61362
  • Alias: Chi3l1(Chitinase-3-like protein 1)/HCgp39/YKL-40/AW208766/Brp39/Chi3l1/gp39/Chitinase 3-like 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 37.5pg/ml

Rat Chi3l1(Chitinase-3-like protein 1) ELISA Kit

ER1804 96T
EUR 567.6
  • Detection range: 78.125-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.875pg/ml

Mouse Chitinase domain- containing protein 1, Chid1 ELISA KIT

ELI-33695m 96 Tests
EUR 865

Mouse Chitinase 3-like 1/YKL-40 ELISA Kit

LF-EK50991 1×96T
EUR 648

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

CHIT1 Conjugated Antibody

C46490 100ul
EUR 397

Chitotriosidase (CHIT1) Antibody

20-abx225108
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

CHIT1 cloning plasmid

CSB-CL623792HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1401
  • Sequence: ATGGTGCGGTCTGTGGCCTGGGCAGGTTTCATGGTCCTGCTGATGATCCCATGGGGCTCTGCTGCAAAACTGGTCTGCTACTTCACCAACTGGGCCCAGTACAGACAGGGGGAGGCTCGCTTCCTGCCCAAGGACTTGGACCCCAGCCTTTGCACCCACCTCATCTACGCCTTCG
  • Show more
Description: A cloning plasmid for the CHIT1 gene.

CHIT1 Rabbit pAb

A2015-100ul 100 ul
EUR 308

CHIT1 Rabbit pAb

A2015-200ul 200 ul
EUR 459

CHIT1 Rabbit pAb

A2015-20ul 20 ul
EUR 183

CHIT1 Rabbit pAb

A2015-50ul 50 ul
EUR 223

anti- CHIT1 antibody

FNab01651 100µg
EUR 505.25
  • Immunogen: chitinase 1(chitotriosidase)
  • Uniprot ID: Q13231
  • Gene ID: 1118
  • Research Area: Metabolism
Description: Antibody raised against CHIT1

anti-CHIT1 (1D9G2)

LF-MA30252 100 ul
EUR 486
Description: Mouse Monoclonal to CHIT1

Anti-CHIT1 antibody

PAab01651 100 ug
EUR 355

Anti-CHIT1 antibody

STJ23126 100 µl
EUR 277
Description: Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene.

Anti-CHIT1 (1D11)

YF-MA12438 100 ug
EUR 363
Description: Mouse monoclonal to CHIT1

Human Chitinase-3-like Protein 1(YKL-40/CHI3L1)ELISA Kit

201-12-2064 96 tests
EUR 440
  • This Chitinase-3-like Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) ELISA kit

E01C1675-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) ELISA kit

E01C1675-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) ELISA kit

E01C1675-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase-3-like Protein 1(YKL-40/CHI3L1)ELISA Kit

CSB-E13608h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Chitinase-3-like Protein 1 (YKL-40/CHI3L1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Chitinase-3-like Protein 1(YKL-40/CHI3L1)ELISA Kit

1-CSB-E13608h
  • EUR 602.00
  • EUR 4238.00
  • EUR 2256.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Chitinase-3-like Protein 1(YKL-40/CHI3L1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Chitinase-3-like Protein 1(YKL-40/CHI3L1)ELISA Kit

QY-E02938 96T
EUR 400

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

CHIT1 ORF Vector (Human) (pORF)

ORF012678 1.0 ug DNA
EUR 354

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

ELISA kit for Human Chitinase-3-like Protein 1 (YKL-40/CHI3L1)ELISA Kit

EK0181 96 tests
EUR 712
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Chitinase-3-like Protein 1 (YKL-40/CHI3L1)ELISA Kit in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Chitinase-3-like protein 1 (CHI3L1)

1-CSB-EP005346HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 60.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chitinase-3-like protein 1(CHI3L1) expressed in E.coli

Human Chitinase domain-containing protein 1 (CHID1)

1-CSB-EP883614HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 46.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chitinase domain-containing protein 1(CHID1) expressed in E.coli

Human Chitinase domain-containing protein 1 (CHID1)

1-CSB-MP883614HU
  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 46.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chitinase domain-containing protein 1(CHID1) expressed in Mammalian cell

Human Chitinase domain-containing protein 1 (CHID1)

1-CSB-YP883614HU
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 44.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chitinase domain-containing protein 1(CHID1) expressed in Yeast

Rat Acidic mammalian chitinase(CHIA) ELISA kit

E02A1812-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acidic mammalian chitinase(CHIA) ELISA kit

E02A1812-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acidic mammalian chitinase(CHIA) ELISA kit

E02A1812-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chia/ Acidic mammalian chitinase ELISA Kit

E0202Ra 1 Kit
EUR 646

Mouse Chia/ Acidic mammalian chitinase ELISA Kit

E0289Mo 1 Kit
EUR 632

Goat Acidic mammalian chitinase(CHIA) ELISA kit

E06A1812-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acidic mammalian chitinase(CHIA) ELISA kit

E06A1812-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acidic mammalian chitinase(CHIA) ELISA kit

E06A1812-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acidic mammalian chitinase(CHIA) ELISA kit

E03A1812-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acidic mammalian chitinase(CHIA) ELISA kit

E03A1812-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acidic mammalian chitinase(CHIA) ELISA kit

E03A1812-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acidic mammalian chitinase(CHIA) ELISA kit

E04A1812-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acidic mammalian chitinase(CHIA) ELISA kit

E04A1812-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acidic mammalian chitinase(CHIA) ELISA kit

E04A1812-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acidic mammalian chitinase(CHIA) ELISA kit

E07A1812-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acidic mammalian chitinase(CHIA) ELISA kit

E07A1812-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acidic mammalian chitinase(CHIA) ELISA kit

E07A1812-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acidic mammalian chitinase(CHIA) ELISA kit

E08A1812-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acidic mammalian chitinase(CHIA) ELISA kit

E08A1812-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acidic mammalian chitinase(CHIA) ELISA kit

E08A1812-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Acidic mammalian chitinase

EK4892 96 tests
EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Acidic mammalian chitinase in samples from serum, plasma, tissue homogenates and other biological fluids.

Monkey Acidic mammalian chitinase(CHIA) ELISA kit

E09A1812-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acidic mammalian chitinase(CHIA) ELISA kit

E09A1812-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acidic mammalian chitinase(CHIA) ELISA kit

E09A1812-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acidic mammalian chitinase, Chia ELISA KIT

ELI-25630m 96 Tests
EUR 865

Mouse Chia( Acidic mammalian chitinase) ELISA Kit

EM0805 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q91XA9
  • Alias: Chia/Lung-specific protein TSA1902/AMCase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Bovine Acidic mammalian chitinase, CHIA ELISA KIT

ELI-50734b 96 Tests
EUR 928