Human CHIT1(Chitinase 1) ELISA Kit

Human CHIT1(Chitinase 1) ELISA Kit

To Order Contact us: 

Mouse Chitinase 1 (CHIT1) ELISA Kit
RDR-CHIT1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Chitinase 1 (CHIT1) ELISA Kit
RD-CHIT1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Chitinase 1 (CHIT1) ELISA Kit
RD-CHIT1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Chitinase 1 (CHIT1) ELISA Kit
20-abx151052	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Chitinase 1 (CHIT1) ELISA Kit
abx250839-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Chitinase 1 (CHIT1) ELISA Kit
abx516697-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Chitinase 1(CHIT1)ELISA Kit
QY-E02939	Qayee Biotechnology	96T	EUR 400

Human Chitinase 1 ELISA Kit (CHIT1)
RK01109	Abclonal	96 Tests	EUR 521

Human Chitinase 1 (CHIT1) ELISA Kit
SEJ374Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Chitinase 1 (CHIT1) ELISA Kit
SEJ374Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Chitinase 1 (CHIT1) ELISA Kit
SEJ374Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Chitinase 1 (CHIT1) ELISA Kit
SEJ374Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Human Chitinase 1 (CHIT1) ELISA Kit
4-SEJ374Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Chitinase 1 elisa. Alternative names of the recognized antigen: CHI3 Chitotriosidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Chitinase 1 (CHIT1) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Chitinase 1 (CHIT1) ELISA Kit
20-abx153818	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Chitinase 1 (CHIT1) ELISA Kit
abx570991-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Mouse Chitinase 1 ELISA Kit (CHIT1)
RK02685	Abclonal	96 Tests	EUR 521

Mouse Chitinase 1 (CHIT1) ELISA Kit
SEJ374Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Chitinase 1 (CHIT1) ELISA Kit
SEJ374Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Chitinase 1 (CHIT1) ELISA Kit
SEJ374Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Chitinase 1 (CHIT1) ELISA Kit
SEJ374Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Chitinase 1 (CHIT1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Chitinase 1 (CHIT1) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Chitinase 1 (CHIT1) ELISA Kit
4-SEJ374Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Chitinase 1 elisa. Alternative names of the recognized antigen: CHI3 Chitotriosidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Chitinase 1 (CHIT1) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E01C1680-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E01C1680-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E01C1680-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human CHIT1 (Chitinase 1)
ELK4932	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chitinase 1 (CHIT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Chitinase 1 (C Show more
Description: A sandwich ELISA kit for detection of Chitinase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human chitinase 1 (chitotriosidase) (CHIT1)ELISA kit
CSB-E17930h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human chitinase 1 (chitotriosidase) (CHIT1) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human chitinase 1 (chitotriosidase) (CHIT1)ELISA kit
1-CSB-E17930h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human chitinase 1 (chitotriosidase) (CHIT1) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Chitinase 1 (CHIT1) Antibody
20-abx006278	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Chitinase 1 (CHIT1) Antibody
abx015729-100ul	Abbexa	100 ul	EUR 411
Shipped within 5-10 working days.

Chitinase 1 (CHIT1) Antibody
20-abx175827	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Chitinase 1 (CHIT1) Antibody
20-abx175828	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Chitinase 1 (CHIT1) Antibody
20-abx100901	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Chitinase 1 (CHIT1) Antibody
20-abx130881	Abbexa	EUR 314.00 EUR 133.00 EUR 829.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Chitinase 1 (CHIT1) Antibody
20-abx171702	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Chitinase 1 (CHIT1) Antibody
abx340166-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Chitinase 1 (CHIT1) Antibody
abx432499-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Chitinase 1 (CHIT1) Antibody
abx231651-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant Chitinase 1 (CHIT1)
4-RPJ374Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q13231 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Chitinase 1 expressed in: E.coli

Recombinant Chitinase 1 (CHIT1)
4-RPJ374Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9D7Q1 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.5kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Chitinase 1 expressed in: E.coli

Human Chitinase 1 (CHIT1) CLIA Kit
20-abx495703	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Chitinase 1 (CHIT1) Protein
20-abx650761	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E02C1680-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E02C1680-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E02C1680-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E03C1680-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E03C1680-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E03C1680-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E06C1680-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E06C1680-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E06C1680-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E04C1680-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E04C1680-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E04C1680-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E07C1680-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E07C1680-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E07C1680-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E09C1680-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E09C1680-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E09C1680-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E08C1680-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E08C1680-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E08C1680-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse CHIT1 (Chitinase 1)
ELK6315	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Chitinase 1 (CHIT1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Chitinase 1 (C Show more
Description: A sandwich ELISA kit for detection of Chitinase 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Chitinase 1 (CHIT1) CLIA Kit
20-abx495704	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Chitinase 1 (CHIT1) Antibody (Biotin)
20-abx271840	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Chitinase 1 (CHIT1) Protein
20-abx650762	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human)
4-PAJ374Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Ala193~Asn466) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1)

Guinea pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E05C1680-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E05C1680-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig chitinase 1 (chitotriosidase) (CHIT1) ELISA kit
E05C1680-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig chitinase 1 (chitotriosidase) (CHIT1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), APC
4-PAJ374Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Ala193~Asn466) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with APC.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), Biotinylated
4-PAJ374Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Ala193~Asn466) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with Biotin.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), Cy3
4-PAJ374Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Ala193~Asn466) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with Cy3.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), FITC
4-PAJ374Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Ala193~Asn466) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with FITC.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), HRP
4-PAJ374Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Ala193~Asn466) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with HRP.

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), PE
4-PAJ374Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Ala193~Asn466) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with PE.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse)
4-PAJ374Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Met210~Ser464) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1)

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Chitinase 1 (CHIT1) Polyclonal Antibody (Human), APC-Cy7
4-PAJ374Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Ala193~Asn466) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chitinase 1 (CHIT1). This antibody is labeled with APC-Cy7.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), APC
4-PAJ374Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Met210~Ser464) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with APC.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), Biotinylated
4-PAJ374Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Met210~Ser464) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with Biotin.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), Cy3
4-PAJ374Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Met210~Ser464) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with Cy3.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), FITC
4-PAJ374Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Met210~Ser464) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with FITC.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), HRP
4-PAJ374Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Met210~Ser464) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with HRP.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), PE
4-PAJ374Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Met210~Ser464) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with PE.

Chitinase 1 (CHIT1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAJ374Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CHIT1 (Met210~Ser464) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chitinase 1 (CHIT1). This antibody is labeled with APC-Cy7.

Human CHIT1 ELISA Kit
ELA-E13980h	Lifescience Market	96 Tests	EUR 824

CHIT1 ELISA KIT|Human
EF005704	Lifescience Market	96 Tests	EUR 689

Human CHIT1/ Chitotriosidase-1 ELISA Kit
E0494Hu	Sunlong	1 Kit	EUR 605

Human CHIT1(Chitotriosidase-1) ELISA Kit
EH1551	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q13231 Alias: CHIT1/Chitotriosidase-1/Chitinase-1/CHI3/CHIT/plasma methylumbelliferyl tetra-N-acetylchitotetraoside hydrolase/FLJ00314/MGC125322
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Chitotriosidase- 1, CHIT1 ELISA KIT
ELI-25276h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human CHIT1 (Chitotriosidase-1)
E-EL-H5620	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CHIT1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human CHIT1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human CHIT1 (Chitotriosidase-1) in samples from Serum, Plasma, Cell supernatant

Human CHIT1 PicoKine ELISA Kit
EK2032	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human CHIT1 in cell culture supernates, serum and plasma (heparin, EDTA).

Mouse Chit1/ Chitotriosidase-1 ELISA Kit
E0290Mo	Sunlong	1 Kit	EUR 632

Mouse Chitotriosidase- 1, Chit1 ELISA KIT
ELI-25479m	Lifescience Market	96 Tests	EUR 865

Mouse Chitotriosidase-1(CHIT1) ELISA kit
CSB-EL005352MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Chitotriosidase-1 (CHIT1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Chitotriosidase-1(CHIT1) ELISA kit
1-CSB-EL005352MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Chitotriosidase-1(CHIT1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Chit1 ELISA Kit| Mouse Chitotriosidase-1 ELISA Kit
EF014475	Lifescience Market	96 Tests	EUR 689

Mouse CHIT1 PicoKine ELISA Kit
EK2033	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse CHIT1 in cell culture supernates, serum and plasma (heparin, EDTA).

Human Chitinase, Acidic (CHIA) ELISA Kit
abx251797-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Chitinase, Acidic(CHIA)ELISA Kit
QY-E01368	Qayee Biotechnology	96T	EUR 400

Chitinase-IN-1
HY-18598	MedChemExpress	10mM/1mL	EUR 580

CHI3L1 (22-383) Chitinase 3-Like 1 (22-383 a.a) Human Recombinant Protein
PROTP36222-1	BosterBio	Regular: 5ug	EUR 317
Description: CHI3L1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 370 amino acids (22-383 a.a.) and having a molecular mass of 41.4kDa (Migrates at 40-57kDa on SDS-PAGE under reducing conditions).CHI3L1 is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Human CHID1/ Chitinase domain-containing protein 1 ELISA Kit
E0493Hu	Sunlong	1 Kit	EUR 605

Human Chitinase domain containing protein 1(CHID1) ELISA kit
E01C1679-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase domain containing protein 1(CHID1) ELISA kit
E01C1679-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase domain containing protein 1(CHID1) ELISA kit
E01C1679-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase Domain-Containing Protein 1 (CHID1) ELISA Kit
abx251898-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Chitinase domain-containing protein 1
EK5060	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Chitinase domain-containing protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CHID1(Chitinase domain-containing protein 1) ELISA Kit
EH2526	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q9BWS9 Alias: CHID1/Chitinase domain-containing protein 1/Stabilin-1-interacting chitinase-like protein(SI-CLP)
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

ELISA kit for Human Chitinase-3-like protein 1
EK3439	SAB	96 tests	EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Chitinase-3-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CHI3L1/ Chitinase-3-like protein 1 ELISA Kit
E2758Hu	Sunlong	1 Kit	EUR 537

Human CHI3L1(Chitinase-3-like protein 1) ELISA Kit
EH0093	FN Test	96T	EUR 524.1
Detection range: 62.5-4000 pg/ml Uniprot ID: P36222 Alias: CHI3L1(Chitinase-3-like protein 1)/GP39/Glycoprotein 39, Cartilage/YKL-40/ASRT7/CGP-39/HC-gp39/YYL-40
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 37.5pg/ml

Human Chitinase domain- containing protein 1, CHID1 ELISA KIT
ELI-10148h	Lifescience Market	96 Tests	EUR 824

Human Chitinase- 3- like protein 1, CHI3L1 ELISA KIT
ELI-04790h	Lifescience Market	96 Tests	EUR 824

Human Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit
abx575447-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Chitinase 3-like 1/YKL-40 ELISA Kit
LF-EK50990	Abfrontier	1×96T	EUR 648

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Chitinase Assay Kit
abx298854-100Assays	Abbexa	100 Assays	EUR 582
Shipped within 5-10 working days.

CHIT1 antibody
10R-2159	Fitzgerald	100 ul	EUR 403
Description: Mouse monoclonal CHIT1 antibody

CHIT1 Antibody
46490-100ul	SAB	100ul	EUR 252

CHIT1 siRNA
20-abx911702	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CHIT1 siRNA
20-abx911703	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-CHIT1
YF-PA10935	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to CHIT1

anti-CHIT1
YF-PA10936	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to CHIT1

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

CHI3L2 Human, Chitinase 3-Like 2 Human Recombinant Protein, Sf9
PROTQ15782-1	BosterBio	Regular: 10ug	EUR 317
Description: CHI3L2 produced in Sf9 Baculovirus cells is a single,glycosylated polypeptide chain containing 372 amino acids (27-390a.a.) andhaving a molecular mass of 41.9kDa. (Molecular size on SDS-PAGE will appear atapproximately 40-57kDa).CHI3L2 is expressed with an 8 amino acid His tag atC-Terminus and purified by proprietary chromatographic techniques.

Human Acidic mammalian chitinase(CHIA) ELISA kit
E01A1812-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acidic mammalian chitinase(CHIA) ELISA kit
E01A1812-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acidic mammalian chitinase(CHIA) ELISA kit
E01A1812-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CHIA/ Acidic mammalian chitinase ELISA Kit
E0492Hu	Sunlong	1 Kit	EUR 605

ELISA kit for Human Acidic mammalian chitinase
EK4891	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Acidic mammalian chitinase in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CHIA(Acidic mammalian chitinase) ELISA Kit
EH2434	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q9BZP6 Alias: CHIA/Lung-specific protein TSA1902/AMCase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Acidic mammalian chitinase(CHIA) ELISA kit
CSB-EL005348HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acidic mammalian chitinase (CHIA) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Acidic mammalian chitinase(CHIA) ELISA kit
1-CSB-EL005348HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Acidic mammalian chitinase(CHIA) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Acidic mammalian chitinase, CHIA ELISA KIT
ELI-50735h	Lifescience Market	96 Tests	EUR 824

Human CHIT1 shRNA Plasmid
20-abx950798	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Recombinant Human CHIT1 Protein
RP00248	Abclonal	20 μg	EUR 311

CHIT1 Recombinant Protein (Human)
RP038032	ABM	100 ug	Ask for price

Human Chitinase 3-like 1/YKL-40 PicoKine ELISA Kit
EK0974	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Chitinase 3-like 1 in cell culture supernates, serum, plasma(heparin, EDTA) and urine.

Recombinant Human Chitotriosidase-1/CHIT1 (C-6His)
C451-10ug	Novoprotein	10ug	EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.

Recombinant Human Chitotriosidase-1/CHIT1 (C-6His)
C451-1mg	Novoprotein	1mg	EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.

Recombinant Human Chitotriosidase-1/CHIT1 (C-6His)
C451-500ug	Novoprotein	500ug	EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.

Recombinant Human Chitotriosidase-1/CHIT1 (C-6His)
C451-50ug	Novoprotein	50ug	EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 150mM NaCl, pH 7.5.

CHIT1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0445202	ABM	1.0 ug DNA	EUR 154

Mouse Chitinase, Acidic (CHIA) ELISA Kit
abx255153-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Cow Chitinase, Acidic (CHIA) ELISA Kit
abx520956-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Chitinase, Acidic (CHIA) ELISA Kit
abx520959-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

CHI3L1 ELISA Kit| Bovine Chitinase-3-like protein 1 ELISA Kit
EF011031	Lifescience Market	96 Tests	EUR 689

Chi3l1 ELISA Kit| Mouse Chitinase-3-like protein 1 ELISA Kit
EF012846	Lifescience Market	96 Tests	EUR 689

ELISA kit for Mouse CHI3L1 (Chitinase 3-like 1)
E-EL-M0016	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's CHI3L1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CHI3L1. Standards or samples are added to the micro ELISA plate wells and combined wit Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CHI3L1 (Chitinase 3-like 1) in samples from Serum, Plasma, Cell supernatant

Bovine CHI3L1/ Chitinase-3-like protein 1 ELISA Kit
E0066Bo	Sunlong	1 Kit	EUR 717

Rat Chitinase domain containing protein 1(CHID1) ELISA kit
E02C1679-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chitinase domain containing protein 1(CHID1) ELISA kit
E02C1679-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chitinase domain containing protein 1(CHID1) ELISA kit
E02C1679-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chid1/ Chitinase domain-containing protein 1 ELISA Kit
E0203Ra	Sunlong	1 Kit	EUR 646

Mouse Chi3l1/ Chitinase-3-like protein 1 ELISA Kit
E0286Mo	Sunlong	1 Kit	EUR 546

Mouse Chitinase domain containing protein 1(CHID1) ELISA kit
E03C1679-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chitinase domain containing protein 1(CHID1) ELISA kit
E03C1679-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chitinase domain containing protein 1(CHID1) ELISA kit
E03C1679-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chitinase domain containing protein 1(CHID1) ELISA kit
E06C1679-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chitinase domain containing protein 1(CHID1) ELISA kit
E06C1679-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Chitinase domain containing protein 1(CHID1) ELISA kit
E06C1679-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chitinase domain containing protein 1(CHID1) ELISA kit
E04C1679-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chitinase domain containing protein 1(CHID1) ELISA kit
E04C1679-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Chitinase domain containing protein 1(CHID1) ELISA kit
E04C1679-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chitinase domain containing protein 1(CHID1) ELISA kit
E07C1679-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chitinase domain containing protein 1(CHID1) ELISA kit
E07C1679-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Chitinase domain containing protein 1(CHID1) ELISA kit
E07C1679-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit
abx254010-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Cow Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit
abx257794-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Rat Chitinase-3-like protein 1 (Chi3l1) ELISA Kit
abx259339-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Monkey Chitinase domain containing protein 1(CHID1) ELISA kit
E09C1679-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chitinase domain containing protein 1(CHID1) ELISA kit
E09C1679-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Chitinase domain containing protein 1(CHID1) ELISA kit
E09C1679-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Bovine Chitinase-3-like protein 1
EK3440	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Bovine Chitinase-3-like protein 1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Dog Chitinase domain containing protein 1(CHID1) ELISA kit
E08C1679-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chitinase domain containing protein 1(CHID1) ELISA kit
E08C1679-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Chitinase domain containing protein 1(CHID1) ELISA kit
E08C1679-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Chitinase domain containing protein 1(CHID1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine CHI3L1(Chitinase-3-like protein 1) ELISA Kit
EB0079	FN Test	96T	EUR 567.6
Detection range: 1.563-100 ng/ml Alias: Chitinase-3-like protein 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Cattle;Sensitivity: 0.938 ng/ml

Bovine Chitinase domain- containing protein 1, CHID1 ELISA KIT
ELI-25746b	Lifescience Market	96 Tests	EUR 928

Rat Chitinase- 3- like protein 1, Chi3l1 ELISA KIT
ELI-04788r	Lifescience Market	96 Tests	EUR 886

Mouse Chitinase- 3- like protein 1, Chi3l1 ELISA KIT
ELI-04789m	Lifescience Market	96 Tests	EUR 865

Porcine Chitinase- 3- like protein 1, CHI3L1 ELISA KIT
ELI-04791p	Lifescience Market	96 Tests	EUR 928

Bovine Chitinase- 3- like protein 1, CHI3L1 ELISA KIT
ELI-04792b	Lifescience Market	96 Tests	EUR 928

Mouse Chitinase-3-like protein 1(CHI3L1) ELISA kit
CSB-EL005346MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Chitinase-3-like protein 1 (CHI3L1) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Chitinase-3-like protein 1(CHI3L1) ELISA kit
1-CSB-EL005346MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Chitinase-3-like protein 1(CHI3L1) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Pig Chitinase-3-like protein 1(CHI3L1) ELISA kit
CSB-EL005346PI-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig Chitinase-3-like protein 1 (CHI3L1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Pig Chitinase-3-like protein 1(CHI3L1) ELISA kit
1-CSB-EL005346PI	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Pig Chitinase-3-like protein 1(CHI3L1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Chitinase-3-like protein 1(CHI3L1) ELISA kit
CSB-EL005346RA-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Chitinase-3-like protein 1 (CHI3L1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Chitinase-3-like protein 1(CHI3L1) ELISA kit
1-CSB-EL005346RA	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Chitinase-3-like protein 1(CHI3L1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cow Chitinase Domain-Containing Protein 1 (CHID1) ELISA Kit
abx521378-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Chitinase Domain-Containing Protein 1 (CHID1) ELISA Kit
abx521380-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Chitinase Domain-Containing Protein 1 (CHID1) ELISA Kit
abx521381-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit
abx575321-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit
abx517044-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Pig Chitinase-3-like Protein 1 (CHI3L1) ELISA Kit
abx517045-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Chi3l1( Chitinase-3-like protein 1) ELISA Kit
EM0057	FN Test	96T	EUR 524.1
Detection range: 62.5-4000 pg/ml Uniprot ID: Q61362 Alias: Chi3l1(Chitinase-3-like protein 1)/HCgp39/YKL-40/AW208766/Brp39/Chi3l1/gp39/Chitinase 3-like 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 37.5pg/ml

Rat Chi3l1(Chitinase-3-like protein 1) ELISA Kit
ER1804	FN Test	96T	EUR 567.6
Detection range: 78.125-5000 pg/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 46.875pg/ml

Mouse Chitinase domain- containing protein 1, Chid1 ELISA KIT
ELI-33695m	Lifescience Market	96 Tests	EUR 865

Mouse Chitinase 3-like 1/YKL-40 ELISA Kit
LF-EK50991	Abfrontier	1×96T	EUR 648

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

CHIT1 Conjugated Antibody
C46490	SAB	100ul	EUR 397

Chitotriosidase (CHIT1) Antibody
20-abx225108	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

CHIT1 cloning plasmid
CSB-CL623792HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1401 Sequence: ATGGTGCGGTCTGTGGCCTGGGCAGGTTTCATGGTCCTGCTGATGATCCCATGGGGCTCTGCTGCAAAACTGGTCTGCTACTTCACCAACTGGGCCCAGTACAGACAGGGGGAGGCTCGCTTCCTGCCCAAGGACTTGGACCCCAGCCTTTGCACCCACCTCATCTACGCCTTCG Show more
Description: A cloning plasmid for the CHIT1 gene.

CHIT1 Rabbit pAb
A2015-100ul	Abclonal	100 ul	EUR 308

CHIT1 Rabbit pAb
A2015-200ul	Abclonal	200 ul	EUR 459

CHIT1 Rabbit pAb
A2015-20ul	Abclonal	20 ul	EUR 183

CHIT1 Rabbit pAb
A2015-50ul	Abclonal	50 ul	EUR 223

anti- CHIT1 antibody
FNab01651	FN Test	100µg	EUR 505.25
Immunogen: chitinase 1(chitotriosidase) Uniprot ID: Q13231 Gene ID: 1118 Research Area: Metabolism
Description: Antibody raised against CHIT1

anti-CHIT1 (1D9G2)
LF-MA30252	Abfrontier	100 ul	EUR 486
Description: Mouse Monoclonal to CHIT1

Anti-CHIT1 antibody
PAab01651	Lifescience Market	100 ug	EUR 355

Anti-CHIT1 antibody
STJ23126	St John's Laboratory	100 µl	EUR 277
Description: Chitotriosidase is secreted by activated human macrophages and is markedly elevated in plasma of Gaucher disease patients. The expression of chitotriosidase occurs only at a late stage of differentiation of monocytes to activated macrophages in culture. Human macrophages can synthesize a functional chitotriosidase, a highly conserved enzyme with a strongly regulated expression. This enzyme may play a role in the degradation of chitin-containing pathogens. Several alternatively spliced transcript variants have been described for this gene.

Anti-CHIT1 (1D11)
YF-MA12438	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to CHIT1

Human Chitinase-3-like Protein 1(YKL-40/CHI3L1)ELISA Kit
201-12-2064	SunredBio	96 tests	EUR 440
This Chitinase-3-like Protein 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) ELISA kit
E01C1675-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) ELISA kit
E01C1675-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) ELISA kit
E01C1675-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Chitinase 3 like Protein 1(YKL 40/CHI3L1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Chitinase-3-like Protein 1(YKL-40/CHI3L1)ELISA Kit
CSB-E13608h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Chitinase-3-like Protein 1 (YKL-40/CHI3L1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Chitinase-3-like Protein 1(YKL-40/CHI3L1)ELISA Kit
1-CSB-E13608h	Cusabio	EUR 602.00 EUR 4238.00 EUR 2256.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Chitinase-3-like Protein 1(YKL-40/CHI3L1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Chitinase-3-like Protein 1(YKL-40/CHI3L1)ELISA Kit
QY-E02938	Qayee Biotechnology	96T	EUR 400

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

CHIT1 ORF Vector (Human) (pORF)
ORF012678	ABM	1.0 ug DNA	EUR 354

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

ELISA kit for Human Chitinase-3-like Protein 1 (YKL-40/CHI3L1)ELISA Kit
EK0181	SAB	96 tests	EUR 712
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Chitinase-3-like Protein 1 (YKL-40/CHI3L1)ELISA Kit in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Chitinase-3-like protein 1 (CHI3L1)
1-CSB-EP005346HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 60.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chitinase-3-like protein 1(CHI3L1) expressed in E.coli

Human Chitinase domain-containing protein 1 (CHID1)
1-CSB-EP883614HU	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 46.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chitinase domain-containing protein 1(CHID1) expressed in E.coli

Human Chitinase domain-containing protein 1 (CHID1)
1-CSB-MP883614HU	Cusabio	EUR 293.00 EUR 963.00 EUR 409.00 EUR 717.00	100ug 1MG 200ug 500ug
MW: 46.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chitinase domain-containing protein 1(CHID1) expressed in Mammalian cell

Human Chitinase domain-containing protein 1 (CHID1)
1-CSB-YP883614HU	Cusabio	EUR 586.00 EUR 299.00 EUR 2172.00 EUR 900.00 EUR 1442.00 EUR 382.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 44.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Chitinase domain-containing protein 1(CHID1) expressed in Yeast

Rat Acidic mammalian chitinase(CHIA) ELISA kit
E02A1812-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acidic mammalian chitinase(CHIA) ELISA kit
E02A1812-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acidic mammalian chitinase(CHIA) ELISA kit
E02A1812-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Chia/ Acidic mammalian chitinase ELISA Kit
E0202Ra	Sunlong	1 Kit	EUR 646

Mouse Chia/ Acidic mammalian chitinase ELISA Kit
E0289Mo	Sunlong	1 Kit	EUR 632

Goat Acidic mammalian chitinase(CHIA) ELISA kit
E06A1812-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acidic mammalian chitinase(CHIA) ELISA kit
E06A1812-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acidic mammalian chitinase(CHIA) ELISA kit
E06A1812-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acidic mammalian chitinase(CHIA) ELISA kit
E03A1812-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acidic mammalian chitinase(CHIA) ELISA kit
E03A1812-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acidic mammalian chitinase(CHIA) ELISA kit
E03A1812-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acidic mammalian chitinase(CHIA) ELISA kit
E04A1812-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acidic mammalian chitinase(CHIA) ELISA kit
E04A1812-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acidic mammalian chitinase(CHIA) ELISA kit
E04A1812-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acidic mammalian chitinase(CHIA) ELISA kit
E07A1812-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acidic mammalian chitinase(CHIA) ELISA kit
E07A1812-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acidic mammalian chitinase(CHIA) ELISA kit
E07A1812-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acidic mammalian chitinase(CHIA) ELISA kit
E08A1812-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acidic mammalian chitinase(CHIA) ELISA kit
E08A1812-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acidic mammalian chitinase(CHIA) ELISA kit
E08A1812-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Mouse Acidic mammalian chitinase
EK4892	SAB	96 tests	EUR 603
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Acidic mammalian chitinase in samples from serum, plasma, tissue homogenates and other biological fluids.

Monkey Acidic mammalian chitinase(CHIA) ELISA kit
E09A1812-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acidic mammalian chitinase(CHIA) ELISA kit
E09A1812-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acidic mammalian chitinase(CHIA) ELISA kit
E09A1812-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Acidic mammalian chitinase(CHIA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acidic mammalian chitinase, Chia ELISA KIT
ELI-25630m	Lifescience Market	96 Tests	EUR 865

Mouse Chia( Acidic mammalian chitinase) ELISA Kit
EM0805	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q91XA9 Alias: Chia/Lung-specific protein TSA1902/AMCase
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Bovine Acidic mammalian chitinase, CHIA ELISA KIT
ELI-50734b	Lifescience Market	96 Tests	EUR 928