Human ZYX(Zyxin) ELISA Kit

Human ZYX(Zyxin) ELISA Kit

To Order Contact us: 

Human Zyxin(ZYX)ELISA Kit
GA-E1505HM-48T	GenAsia Biotech	48T	EUR 289

Human Zyxin(ZYX)ELISA Kit
GA-E1505HM-96T	GenAsia Biotech	96T	EUR 466

Human Zyxin (ZYX) ELISA Kit
20-abx153537	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Zyxin(ZYX) ELISA kit
CSB-EL027165HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Zyxin (ZYX) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Zyxin(ZYX) ELISA kit
1-CSB-EL027165HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Zyxin(ZYX) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Zyxin (ZYX) ELISA Kit
SEC235Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit
SEC235Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit
SEC235Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit
SEC235Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit
4-SEC235Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Zyxin elisa. Alternative names of the recognized antigen: ESP2 HED2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Zyxin (ZYX) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Zyxin ELISA Kit (ZYX)
RK02541	Abclonal	96 Tests	EUR 521

Human Zyxin(ZYX)ELISA Kit
QY-E04229	Qayee Biotechnology	96T	EUR 361

Chicken Zyxin (ZYX) ELISA Kit
abx555364-96tests	Abbexa	96 tests	EUR 911
Shipped within 1-3 weeks.

Mouse Zyxin (ZYX) ELISA Kit
abx556120-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Chicken Zyxin, ZYX ELISA KIT
ELI-14746c	Lifescience Market	96 Tests	EUR 928

Mouse Zyxin, Zyx ELISA KIT
ELI-40811m	Lifescience Market	96 Tests	EUR 865

Zyxin (ZYX) Antibody
20-abx116771	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Zyxin (ZYX) Antibody
20-abx001747	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Zyxin (ZYX) Antibody
abx037464-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Zyxin (ZYX) Antibody
20-abx100030	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Zyxin (ZYX) Antibody
20-abx100031	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Zyxin (ZYX) Antibody
20-abx175170	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Zyxin (ZYX) Antibody
abx433465-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Zyxin (ZYX) Antibody
abx239764-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Zyxin (ZYX) Antibody
abx239765-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Recombinant Zyxin (ZYX)
4-RPC235Hu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q15942 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 22.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Zyxin expressed in: E.coli

Recombinant Zyxin (ZYX)
4-RPC235Hu02	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q15942 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Zyxin expressed in: E.coli

ELISA kit for Human ZYX (Zyxin)
ELK4891	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Zyxin (ZYX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Zyxin (ZYX). Next, Avi Show more
Description: A sandwich ELISA kit for detection of Zyxin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Zyxin (ZYX)
KTE62447-48T	Abbkine	48T	EUR 332
Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and Show more
Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Zyxin (ZYX)
KTE62447-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and Show more
Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Zyxin (ZYX)
KTE62447-96T	Abbkine	96T	EUR 539
Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and Show more
Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Zyxin (ZYX) CLIA Kit
20-abx493561	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Zyxin (ZYX) Protein
20-abx069720	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human Zyxin (ZYX) Protein
20-abx069721	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Zyx ELISA Kit| Mouse Zyxin ELISA Kit
EF016536	Lifescience Market	96 Tests	EUR 689

ZYX ELISA Kit| chicken Zyxin ELISA Kit
EF012568	Lifescience Market	96 Tests	EUR 689

Zyxin (ZYX) Antibody (FITC)
20-abx273635	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Zyxin (ZYX) Antibody (Biotin)
20-abx272263	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Zyxin (ZYX) Polyclonal Antibody (Human)
4-PAC235Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Cys384~Thr572) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX)

Zyxin (ZYX) Polyclonal Antibody (Human)
4-PAC235Hu02	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Asn377~Val523) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX)

Zyxin (ZYX) Monoclonal Antibody (Human)
4-MAC235Hu21	Cloud-Clone	EUR 255.00 EUR 2642.00 EUR 655.00 EUR 322.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX)

Zyxin (ZYX) Polyclonal Antibody (Human), APC
4-PAC235Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Cys384~Thr572) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.

Zyxin (ZYX) Polyclonal Antibody (Human), Biotinylated
4-PAC235Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Cys384~Thr572) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.

Zyxin (ZYX) Polyclonal Antibody (Human), Cy3
4-PAC235Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Cys384~Thr572) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.

Zyxin (ZYX) Polyclonal Antibody (Human), FITC
4-PAC235Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Cys384~Thr572) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.

Zyxin (ZYX) Polyclonal Antibody (Human), HRP
4-PAC235Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Cys384~Thr572) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.

Zyxin (ZYX) Polyclonal Antibody (Human), PE
4-PAC235Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Cys384~Thr572) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.

Zyxin (ZYX) Polyclonal Antibody (Human), APC
4-PAC235Hu02-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Asn377~Val523) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.

Zyxin (ZYX) Polyclonal Antibody (Human), Biotinylated
4-PAC235Hu02-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Asn377~Val523) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.

Zyxin (ZYX) Polyclonal Antibody (Human), Cy3
4-PAC235Hu02-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Asn377~Val523) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.

Zyxin (ZYX) Polyclonal Antibody (Human), FITC
4-PAC235Hu02-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Asn377~Val523) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.

Zyxin (ZYX) Polyclonal Antibody (Human), HRP
4-PAC235Hu02-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Asn377~Val523) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.

Zyxin (ZYX) Polyclonal Antibody (Human), PE
4-PAC235Hu02-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Asn377~Val523) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.

Zyxin (ZYX) Monoclonal Antibody (Human), APC
4-MAC235Hu21-APC	Cloud-Clone	EUR 358.00 EUR 3455.00 EUR 957.00 EUR 458.00 EUR 224.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.

Zyxin (ZYX) Monoclonal Antibody (Human), Biotinylated
4-MAC235Hu21-Biotin	Cloud-Clone	EUR 320.00 EUR 2592.00 EUR 760.00 EUR 394.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.

Zyxin (ZYX) Monoclonal Antibody (Human), Cy3
4-MAC235Hu21-Cy3	Cloud-Clone	EUR 435.00 EUR 4565.00 EUR 1235.00 EUR 569.00 EUR 258.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.

Zyxin (ZYX) Monoclonal Antibody (Human), FITC
4-MAC235Hu21-FITC	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.

Zyxin (ZYX) Monoclonal Antibody (Human), HRP
4-MAC235Hu21-HRP	Cloud-Clone	EUR 327.00 EUR 3011.00 EUR 846.00 EUR 413.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.

Zyxin (ZYX) Monoclonal Antibody (Human), PE
4-MAC235Hu21-PE	Cloud-Clone	EUR 306.00 EUR 2784.00 EUR 786.00 EUR 386.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.

Zyxin (ZYX) Polyclonal Antibody (Human), APC-Cy7
4-PAC235Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Cys384~Thr572) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.

Zyxin (ZYX) Polyclonal Antibody (Human), APC-Cy7
4-PAC235Hu02-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ZYX (Asn377~Val523) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.

Zyxin (ZYX) Monoclonal Antibody (Human), APC-Cy7
4-MAC235Hu21-APC-Cy7	Cloud-Clone	EUR 596.00 EUR 6790.00 EUR 1795.00 EUR 796.00 EUR 329.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Inquire for antigen sequence. Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.

Zyxin Phospho-Ser142 (ZYX pS142) Antibody
20-abx324004	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Human Zyxin ELISA kit
E01Z0034-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zyxin ELISA kit
E01Z0034-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zyxin ELISA kit
E01Z0034-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Zyxin ELISA KIT|Human
EF004535	Lifescience Market	96 Tests	EUR 689

ZYX ELISA Kit (Human) (OKCD00316)
OKCD00316	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Adhesion plaque protein. Binds alpha-actinin and the CRP protein. Important for targeting TES and ENA/VASP family members to focal adhesions and for the formation of actin-rich structures. May be a component of a signal transduction pathway that mediates adhesion-stimulated changes in gene expression (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.061 ng/mL

ZYX ELISA Kit (Human) (OKCA02157)
OKCA02157	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Adhesion plaque protein. Binds alpha-actinin and the CRP protein. Important for targeting TES and ENA/VASP family members to focal adhesions and for the formation of actin-rich structures. May be a component of a signal transduction pathway that mediates adhesion-stimulated changes in gene expression.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL

ZYX ELISA Kit (Human) (OKEH08197)
OKEH08197	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 29pg/mL

Mouse Zyxin ELISA kit
E03Z0034-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zyxin ELISA kit
E03Z0034-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zyxin ELISA kit
E03Z0034-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zyxin ELISA kit
E02Z0034-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zyxin ELISA kit
E02Z0034-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zyxin ELISA kit
E02Z0034-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zyxin ELISA kit
E04Z0034-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zyxin ELISA kit
E04Z0034-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zyxin ELISA kit
E04Z0034-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zyxin ELISA kit
E07Z0034-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zyxin ELISA kit
E07Z0034-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zyxin ELISA kit
E07Z0034-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zyxin ELISA kit
E08Z0034-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zyxin ELISA kit
E08Z0034-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zyxin ELISA kit
E08Z0034-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zyxin ELISA kit
E06Z0034-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zyxin ELISA kit
E06Z0034-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zyxin ELISA kit
E06Z0034-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zyxin ELISA kit
E09Z0034-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zyxin ELISA kit
E09Z0034-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zyxin ELISA kit
E09Z0034-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Zyxin ELISA kit
E05Z0034-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Zyxin ELISA kit
E05Z0034-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Zyxin ELISA kit
E05Z0034-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Alleleustrious pmTFP1-Zyxin fusion vector Zyxin
ABP-FP-TZY	Allele Biotech	5 ug	Ask for price
Product line: Plasmids Brand: Organelle Markers

Alleleustrious pWasabi-Zyxin fusion vector Zyxin
ABP-FP-WZY	Allele Biotech	5 ug	Ask for price
Product line: Plasmids Brand: Organelle Markers

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Zyxin Antibody
AF7902	Affbiotech	200ul	EUR 376
Description: Zyxin Antibody detects endogenous levels of Zyxin.

Zyxin Antibody
AF7903	Affbiotech	200ul	EUR 376
Description: Zyxin Antibody detects endogenous levels of Zyxin.

Zyxin Antibody
39205-100ul	SAB	100ul	EUR 390

Zyxin Antibody
49705-100ul	SAB	100ul	EUR 333

Zyxin Antibody
49705-50ul	SAB	50ul	EUR 239

anti-Zyxin
YF-PA15457	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Zyxin

anti-Zyxin
YF-PA15458	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Zyxin

anti-Zyxin
YF-PA15459	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Zyxin

anti-Zyxin
YF-PA25007	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Zyxin

ZYX siRNA
20-abx941267	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ZYX siRNA
20-abx941268	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ZYX antibody
70R-21425	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ZYX antibody

ZYX Antibody
ABD6858	Lifescience Market	100 ug	EUR 438

ZYX antibody
38377-100ul	SAB	100ul	EUR 252

ZYX Antibody
43893-100ul	SAB	100ul	EUR 252

ZYX Antibody
DF6858	Affbiotech	200ul	EUR 304
Description: ZYX Antibody detects endogenous levels of total ZYX.

ZYX Antibody
1-CSB-PA027165GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ZYX. Recognizes ZYX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Human ZYX shRNA Plasmid
20-abx955275	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ZYX Recombinant Protein (Human)
RP036337	ABM	100 ug	Ask for price

Zyxin Conjugated Antibody
C49705	SAB	100ul	EUR 397

Zyxin Blocking Peptide
AF7902-BP	Affbiotech	1mg	EUR 195

Zyxin Blocking Peptide
AF7903-BP	Affbiotech	1mg	EUR 195

anti- Zyxin antibody
FNab09764	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:200-1:2000 Immunogen: zyxin Uniprot ID: Q15942 Gene ID: 7791 Research Area: Cell Division and Proliferation, Signal Transduction
Description: Antibody raised against Zyxin

anti- Zyxin antibody
FNab09765	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 IF: 1:20-1:200 Immunogen: zyxin Uniprot ID: Q15942 Gene ID: 7791 Research Area: Cell Division and Proliferation, Signal Transduction
Description: Antibody raised against Zyxin

Zyxin antibody (Ser142)
70R-34606	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal Zyxin antibody (Ser142)

Anti-Zyxin antibody
PAab09764	Lifescience Market	100 ug	EUR 412

Anti-Zyxin (2D1)
YF-MA11026	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Zyxin

ZYX Conjugated Antibody
C38377	SAB	100ul	EUR 397

ZYX Conjugated Antibody
C43893	SAB	100ul	EUR 397

ZYX cloning plasmid
CSB-CL027165HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1719 Sequence: atggcggccccccgcccgtctcccgcgatctccgtttcggtctcggctccggctttttacgccccgcagaagaagttcggccctgtggtggccccaaagcccaaagtgaatcccttccggcccggggacagcgagcctcccccggcacccggggcccagcgcgcacagatgggcc Show more
Description: A cloning plasmid for the ZYX gene.

ZYX Rabbit pAb
A2135-100ul	Abclonal	100 ul	EUR 308

ZYX Rabbit pAb
A2135-200ul	Abclonal	200 ul	EUR 459

ZYX Rabbit pAb
A2135-20ul	Abclonal	20 ul	EUR 183

ZYX Rabbit pAb
A2135-50ul	Abclonal	50 ul	EUR 223

ZYX Blocking Peptide
DF6858-BP	Affbiotech	1mg	EUR 195

Anti-ZYX antibody
STJ72081	St John's Laboratory	100 µg	EUR 359

Anti-ZYX antibody
STJ26156	St John's Laboratory	100 µl	EUR 277
Description: Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform.

ZYX ORF Vector (Human) (pORF)
ORF012113	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Phospho-Zyxin (Tyr316) Antibody
AF7402	Affbiotech	200ul	EUR 376
Description: Phospho-Zyxin (Tyr316) Antibody detects endogenous levels of Zyxin only when phosphorylated at Tyr316.

Phospho-Zyxin (Ser143) Antibody
AF7403	Affbiotech	200ul	EUR 376
Description: Phospho-Zyxin (Ser143) Antibody detects endogenous levels of Zyxin only when phosphorylated at Ser143.

Zyxin (Phospho-Tyr316) Antibody
13247-100ul	SAB	100ul	EUR 252

Zyxin (Phospho-Tyr316) Antibody
13247-50ul	SAB	50ul	EUR 187

Zyxin (Phospho-Ser143) Antibody
13248-100ul	SAB	100ul	EUR 252

Zyxin (Phospho-Ser143) Antibody
13248-50ul	SAB	50ul	EUR 187

Anti-Zyxin Monoclonal Antibody
M02365	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal Zyxin Antibody. Validated in IP, IF, WB and tested in Human, Mouse.

Anti-Zyxin (2C10-4A7)
YF-MA16216	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Zyxin

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Mouse ZYX shRNA Plasmid
20-abx973497	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Phospho-ZYX (S142) Antibody
1-CSB-PA060122	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ZYX (S142). Recognizes Phospho-ZYX (S142) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

ZYX Recombinant Protein (Rat)
RP238847	ABM	100 ug	Ask for price

ZYX Recombinant Protein (Mouse)
RP188411	ABM	100 ug	Ask for price

ZYX sgRNA CRISPR Lentivector set (Human)
K2744501	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Zyxin (Phospho-Tyr316) Conjugated Antibody
C13247	SAB	100ul	EUR 397

Zyxin (Phospho-Ser143) Conjugated Antibody
C13248	SAB	100ul	EUR 397

Phospho-Zyxin (Tyr316) Blocking Peptide
AF7402-BP	Affbiotech	1mg	EUR 195

Phospho-Zyxin (Ser143) Blocking Peptide
AF7403-BP	Affbiotech	1mg	EUR 195

Zyxin (phospho Ser142) Polyclonal Antibody
ES7554-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Zyxin (phospho Ser142) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Zyxin (phospho Ser142) Polyclonal Antibody
ES7554-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Zyxin (phospho Ser142) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Zyxin (phospho Ser142) Polyclonal Antibody
ABP56555-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human Zyxin around the phosphorylation site of S142 Applications tips:
Description: A polyclonal antibody for detection of Zyxin phospho Ser142) from Human. This Zyxin phospho Ser142) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Zyxin around the phosphorylation site of S142

Zyxin (phospho Ser142) Polyclonal Antibody
ABP56555-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human Zyxin around the phosphorylation site of S142 Applications tips:
Description: A polyclonal antibody for detection of Zyxin phospho Ser142) from Human. This Zyxin phospho Ser142) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Zyxin around the phosphorylation site of S142

Zyxin (phospho Ser142) Polyclonal Antibody
ABP56555-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from human Zyxin around the phosphorylation site of S142 Applications tips:
Description: A polyclonal antibody for detection of Zyxin phospho Ser142) from Human. This Zyxin phospho Ser142) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Zyxin around the phosphorylation site of S142

Phospho- Zyxin (Ser142/143) Antibody
ABF3801	Lifescience Market	100 ug	EUR 438

CFP-Zyxin fusion Lentiviral particles
LVP449-C	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made lentiviral particles expressing (CFP-human Zyxin) fusion contruct under suCMV promoter, provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.

GFP-Zyxin fusion Lentiviral particles
LVP449-G	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made lentiviral particles expressing (GFP-human Zyxin) fusion contruct under suCMV promoter, provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.

RFP-Zyxin fusion Lentiviral particles
LVP449-R	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made lentiviral particles expressing (RFP-human Zyxin) fusion contruct under suCMV promoter, provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.

Anti-Phospho-Zyxin (S142) antibody
STJ90641	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Phospho-Zyxin (S142).

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Recombinant Human Zyxin Protein, His, Mammal-100ug
QP10108-ma-100ug	EnQuireBio	100ug	EUR 1178

Recombinant Human Zyxin Protein, His, Mammal-20ug
QP10108-ma-20ug	EnQuireBio	20ug	EUR 462

Recombinant Human Zyxin Protein, His, Mammal-50ug
QP10108-ma-50ug	EnQuireBio	50ug	EUR 862

Polyclonal Goat Anti-ZYX Antibody
APR12197G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ZYX . This antibody is tested and proven to work in the following applications:

Zyx ORF Vector (Rat) (pORF)
ORF079617	ABM	1.0 ug DNA	EUR 506

Zyx ORF Vector (Mouse) (pORF)
ORF062805	ABM	1.0 ug DNA	EUR 506