Human ZYX(Zyxin) ELISA Kit

Human ZYX(Zyxin) ELISA Kit

To Order Contact us: 

    Human Zyxin(ZYX)ELISA Kit
    GA-E1505HM-48T 48T
    EUR 289
    Human Zyxin(ZYX)ELISA Kit
    GA-E1505HM-96T 96T
    EUR 466
    Human Zyxin (ZYX) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Zyxin(ZYX) ELISA kit
    CSB-EL027165HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Zyxin (ZYX) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
    Human Zyxin(ZYX) ELISA kit
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Zyxin(ZYX) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
    Human Zyxin (ZYX) ELISA Kit
    SEC235Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Zyxin (ZYX) ELISA Kit
    SEC235Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Zyxin (ZYX) ELISA Kit
    SEC235Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Zyxin (ZYX) ELISA Kit
    SEC235Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.
    Human Zyxin (ZYX) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Zyxin elisa. Alternative names of the recognized antigen: ESP2
    • HED2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Zyxin (ZYX) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human Zyxin ELISA Kit (ZYX)
    RK02541 96 Tests
    EUR 521
    Human Zyxin(ZYX)ELISA Kit
    QY-E04229 96T
    EUR 361
    Chicken Zyxin (ZYX) ELISA Kit
    abx555364-96tests 96 tests
    EUR 911
    • Shipped within 1-3 weeks.
    Mouse Zyxin (ZYX) ELISA Kit
    abx556120-96tests 96 tests
    EUR 668
    • Shipped within 1-3 weeks.
    Chicken Zyxin, ZYX ELISA KIT
    ELI-14746c 96 Tests
    EUR 928
    Mouse Zyxin, Zyx ELISA KIT
    ELI-40811m 96 Tests
    EUR 865
    Zyxin (ZYX) Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Zyxin (ZYX) Antibody
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Zyxin (ZYX) Antibody
    abx037464-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Zyxin (ZYX) Antibody
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Zyxin (ZYX) Antibody
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Zyxin (ZYX) Antibody
    • EUR 342.00
    • EUR 857.00
    • EUR 439.00
    • EUR 154.00
    • EUR 258.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Zyxin (ZYX) Antibody
    abx433465-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    Zyxin (ZYX) Antibody
    abx239764-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.
    Zyxin (ZYX) Antibody
    abx239765-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Recombinant Zyxin (ZYX)
    • EUR 503.20
    • EUR 238.00
    • EUR 1612.00
    • EUR 604.00
    • EUR 1108.00
    • EUR 400.00
    • EUR 3880.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q15942
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 22.6kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Zyxin expressed in: E.coli
    Recombinant Zyxin (ZYX)
    • EUR 503.20
    • EUR 238.00
    • EUR 1612.00
    • EUR 604.00
    • EUR 1108.00
    • EUR 400.00
    • EUR 3880.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q15942
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 17.9kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Zyxin expressed in: E.coli
    ELISA kit for Human ZYX (Zyxin)
    ELK4891 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Zyxin (ZYX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Zyxin (ZYX). Next, Avi
    • Show more
    Description: A sandwich ELISA kit for detection of Zyxin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    ELISA kit for Human Zyxin (ZYX)
    KTE62447-48T 48T
    EUR 332
    • Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Zyxin (ZYX)
    KTE62447-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Human Zyxin (ZYX)
    KTE62447-96T 96T
    EUR 539
    • Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Human Zyxin (ZYX) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Human Zyxin (ZYX) Protein
    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.
    Human Zyxin (ZYX) Protein
    • EUR 704.00
    • EUR 286.00
    • EUR 2165.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Zyx ELISA Kit| Mouse Zyxin ELISA Kit
    EF016536 96 Tests
    EUR 689
    ZYX ELISA Kit| chicken Zyxin ELISA Kit
    EF012568 96 Tests
    EUR 689
    Zyxin (ZYX) Antibody (FITC)
    • EUR 481.00
    • EUR 244.00
    • EUR 1414.00
    • EUR 662.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Zyxin (ZYX) Antibody (Biotin)
    • EUR 453.00
    • EUR 244.00
    • EUR 1316.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Zyxin (ZYX) Polyclonal Antibody (Human)
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Cys384~Thr572)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX)
    Zyxin (ZYX) Polyclonal Antibody (Human)
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Asn377~Val523)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX)
    Zyxin (ZYX) Monoclonal Antibody (Human)
    • EUR 255.00
    • EUR 2642.00
    • EUR 655.00
    • EUR 322.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Inquire for antigen sequence.
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Zyxin (ZYX)
    Zyxin (ZYX) Polyclonal Antibody (Human), APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Cys384~Thr572)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.
    Zyxin (ZYX) Polyclonal Antibody (Human), Biotinylated
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Cys384~Thr572)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.
    Zyxin (ZYX) Polyclonal Antibody (Human), Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Cys384~Thr572)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.
    Zyxin (ZYX) Polyclonal Antibody (Human), FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Cys384~Thr572)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.
    Zyxin (ZYX) Polyclonal Antibody (Human), HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Cys384~Thr572)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.
    Zyxin (ZYX) Polyclonal Antibody (Human), PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Cys384~Thr572)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.
    Zyxin (ZYX) Polyclonal Antibody (Human), APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Asn377~Val523)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.
    Zyxin (ZYX) Polyclonal Antibody (Human), Biotinylated
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Asn377~Val523)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.
    Zyxin (ZYX) Polyclonal Antibody (Human), Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Asn377~Val523)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.
    Zyxin (ZYX) Polyclonal Antibody (Human), FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Asn377~Val523)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.
    Zyxin (ZYX) Polyclonal Antibody (Human), HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Asn377~Val523)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.
    Zyxin (ZYX) Polyclonal Antibody (Human), PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Asn377~Val523)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.
    Zyxin (ZYX) Monoclonal Antibody (Human), APC
    • EUR 358.00
    • EUR 3455.00
    • EUR 957.00
    • EUR 458.00
    • EUR 224.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Inquire for antigen sequence.
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.
    Zyxin (ZYX) Monoclonal Antibody (Human), Biotinylated
    • EUR 320.00
    • EUR 2592.00
    • EUR 760.00
    • EUR 394.00
    • EUR 223.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Inquire for antigen sequence.
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.
    Zyxin (ZYX) Monoclonal Antibody (Human), Cy3
    • EUR 435.00
    • EUR 4565.00
    • EUR 1235.00
    • EUR 569.00
    • EUR 258.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Inquire for antigen sequence.
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.
    Zyxin (ZYX) Monoclonal Antibody (Human), FITC
    • EUR 306.00
    • EUR 2784.00
    • EUR 786.00
    • EUR 386.00
    • EUR 199.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Inquire for antigen sequence.
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.
    Zyxin (ZYX) Monoclonal Antibody (Human), HRP
    • EUR 327.00
    • EUR 3011.00
    • EUR 846.00
    • EUR 413.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Inquire for antigen sequence.
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.
    Zyxin (ZYX) Monoclonal Antibody (Human), PE
    • EUR 306.00
    • EUR 2784.00
    • EUR 786.00
    • EUR 386.00
    • EUR 199.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Inquire for antigen sequence.
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.
    Zyxin (ZYX) Polyclonal Antibody (Human), APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Cys384~Thr572)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.
    Zyxin (ZYX) Polyclonal Antibody (Human), APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ZYX (Asn377~Val523)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.
    Zyxin (ZYX) Monoclonal Antibody (Human), APC-Cy7
    • EUR 596.00
    • EUR 6790.00
    • EUR 1795.00
    • EUR 796.00
    • EUR 329.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Inquire for antigen sequence.
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.
    Zyxin Phospho-Ser142 (ZYX pS142) Antibody
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Human Zyxin ELISA kit
    E01Z0034-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Zyxin ELISA kit
    E01Z0034-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Zyxin ELISA kit
    E01Z0034-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Zyxin ELISA KIT|Human
    EF004535 96 Tests
    EUR 689
    ZYX ELISA Kit (Human) (OKCD00316)
    OKCD00316 96 Wells
    EUR 831
    Description: Description of target: Adhesion plaque protein. Binds alpha-actinin and the CRP protein. Important for targeting TES and ENA/VASP family members to focal adhesions and for the formation of actin-rich structures. May be a component of a signal transduction pathway that mediates adhesion-stimulated changes in gene expression (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.061 ng/mL
    ZYX ELISA Kit (Human) (OKCA02157)
    OKCA02157 96 Wells
    EUR 833
    Description: Description of target: Adhesion plaque protein. Binds alpha-actinin and the CRP protein. Important for targeting TES and ENA/VASP family members to focal adhesions and for the formation of actin-rich structures. May be a component of a signal transduction pathway that mediates adhesion-stimulated changes in gene expression.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL
    ZYX ELISA Kit (Human) (OKEH08197)
    OKEH08197 96 Wells
    EUR 896
    Description: Description of target: Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 29pg/mL
    Mouse Zyxin ELISA kit
    E03Z0034-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Zyxin ELISA kit
    E03Z0034-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Zyxin ELISA kit
    E03Z0034-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Zyxin ELISA kit
    E02Z0034-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Zyxin ELISA kit
    E02Z0034-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Zyxin ELISA kit
    E02Z0034-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Zyxin ELISA kit
    E04Z0034-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Zyxin ELISA kit
    E04Z0034-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Zyxin ELISA kit
    E04Z0034-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Zyxin ELISA kit
    E07Z0034-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Zyxin ELISA kit
    E07Z0034-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Zyxin ELISA kit
    E07Z0034-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Zyxin ELISA kit
    E08Z0034-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Zyxin ELISA kit
    E08Z0034-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Zyxin ELISA kit
    E08Z0034-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Zyxin ELISA kit
    E06Z0034-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Zyxin ELISA kit
    E06Z0034-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Zyxin ELISA kit
    E06Z0034-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Zyxin ELISA kit
    E09Z0034-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Zyxin ELISA kit
    E09Z0034-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Zyxin ELISA kit
    E09Z0034-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Zyxin ELISA kit
    E05Z0034-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Zyxin ELISA kit
    E05Z0034-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Guinea pig Zyxin ELISA kit
    E05Z0034-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Alleleustrious pmTFP1-Zyxin fusion vector Zyxin
    ABP-FP-TZY 5 ug Ask for price
      • Product line: Plasmids
      • Brand: Organelle Markers
    Alleleustrious pWasabi-Zyxin fusion vector Zyxin
    ABP-FP-WZY 5 ug Ask for price
      • Product line: Plasmids
      • Brand: Organelle Markers
    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
    ELISA-1 1
    EUR 202
    Zyxin Antibody
    AF7902 200ul
    EUR 376
    Description: Zyxin Antibody detects endogenous levels of Zyxin.
    Zyxin Antibody
    AF7903 200ul
    EUR 376
    Description: Zyxin Antibody detects endogenous levels of Zyxin.
    Zyxin Antibody
    39205-100ul 100ul
    EUR 390
    Zyxin Antibody
    49705-100ul 100ul
    EUR 333
    Zyxin Antibody
    49705-50ul 50ul
    EUR 239
    YF-PA15457 50 ul
    EUR 363
    Description: Mouse polyclonal to Zyxin
    YF-PA15458 50 ug
    EUR 363
    Description: Mouse polyclonal to Zyxin
    YF-PA15459 100 ug
    EUR 403
    Description: Rabbit polyclonal to Zyxin
    YF-PA25007 50 ul
    EUR 334
    Description: Mouse polyclonal to Zyxin
    ZYX siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    ZYX siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    ZYX antibody
    70R-21425 50 ul
    EUR 435
    Description: Rabbit polyclonal ZYX antibody
    ZYX Antibody
    ABD6858 100 ug
    EUR 438
    ZYX antibody
    38377-100ul 100ul
    EUR 252
    ZYX Antibody
    43893-100ul 100ul
    EUR 252
    ZYX Antibody
    DF6858 200ul
    EUR 304
    Description: ZYX Antibody detects endogenous levels of total ZYX.
    ZYX Antibody
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against ZYX. Recognizes ZYX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
    Human ZYX shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    ZYX Recombinant Protein (Human)
    RP036337 100 ug Ask for price
    Zyxin Conjugated Antibody
    C49705 100ul
    EUR 397
    Zyxin Blocking Peptide
    AF7902-BP 1mg
    EUR 195
    Zyxin Blocking Peptide
    AF7903-BP 1mg
    EUR 195
    anti- Zyxin antibody
    FNab09764 100µg
    EUR 585
    • Recommended dilution: WB: 1:200-1:2000
    • Immunogen: zyxin
    • Uniprot ID: Q15942
    • Gene ID: 7791
    • Research Area: Cell Division and Proliferation, Signal Transduction
    Description: Antibody raised against Zyxin
    anti- Zyxin antibody
    FNab09765 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:5000
    • IHC: 1:20-1:200
    • IF: 1:20-1:200
    • Immunogen: zyxin
    • Uniprot ID: Q15942
    • Gene ID: 7791
    • Research Area: Cell Division and Proliferation, Signal Transduction
    Description: Antibody raised against Zyxin
    Zyxin antibody (Ser142)
    70R-34606 100 ug
    EUR 327
    Description: Purified Rabbit polyclonal Zyxin antibody (Ser142)
    Anti-Zyxin antibody
    PAab09764 100 ug
    EUR 412
    Anti-Zyxin (2D1)
    YF-MA11026 100 ug
    EUR 363
    Description: Mouse monoclonal to Zyxin
    ZYX Conjugated Antibody
    C38377 100ul
    EUR 397
    ZYX Conjugated Antibody
    C43893 100ul
    EUR 397
    ZYX cloning plasmid
    CSB-CL027165HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1719
    • Sequence: atggcggccccccgcccgtctcccgcgatctccgtttcggtctcggctccggctttttacgccccgcagaagaagttcggccctgtggtggccccaaagcccaaagtgaatcccttccggcccggggacagcgagcctcccccggcacccggggcccagcgcgcacagatgggcc
    • Show more
    Description: A cloning plasmid for the ZYX gene.
    ZYX Rabbit pAb
    A2135-100ul 100 ul
    EUR 308
    ZYX Rabbit pAb
    A2135-200ul 200 ul
    EUR 459
    ZYX Rabbit pAb
    A2135-20ul 20 ul
    EUR 183
    ZYX Rabbit pAb
    A2135-50ul 50 ul
    EUR 223
    ZYX Blocking Peptide
    DF6858-BP 1mg
    EUR 195
    Anti-ZYX antibody
    STJ72081 100 µg
    EUR 359
    Anti-ZYX antibody
    STJ26156 100 µl
    EUR 277
    Description: Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform.
    ZYX ORF Vector (Human) (pORF)
    ORF012113 1.0 ug DNA
    EUR 95
    Frit Kit
    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.
    Column Packing Kit
    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.
    Phospho-Zyxin (Tyr316) Antibody
    AF7402 200ul
    EUR 376
    Description: Phospho-Zyxin (Tyr316) Antibody detects endogenous levels of Zyxin only when phosphorylated at Tyr316.
    Phospho-Zyxin (Ser143) Antibody
    AF7403 200ul
    EUR 376
    Description: Phospho-Zyxin (Ser143) Antibody detects endogenous levels of Zyxin only when phosphorylated at Ser143.
    Zyxin (Phospho-Tyr316) Antibody
    13247-100ul 100ul
    EUR 252
    Zyxin (Phospho-Tyr316) Antibody
    13247-50ul 50ul
    EUR 187
    Zyxin (Phospho-Ser143) Antibody
    13248-100ul 100ul
    EUR 252
    Zyxin (Phospho-Ser143) Antibody
    13248-50ul 50ul
    EUR 187
    Anti-Zyxin Monoclonal Antibody
    M02365 100ug
    EUR 397
    Description: Rabbit Monoclonal Zyxin Antibody. Validated in IP, IF, WB and tested in Human, Mouse.
    Anti-Zyxin (2C10-4A7)
    YF-MA16216 100 ug
    EUR 363
    Description: Mouse monoclonal to Zyxin
    PCR Mycoplasma Detection Kit
    M034-Kit Kit
    EUR 266
    Mouse ZYX shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Phospho-ZYX (S142) Antibody
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against Phospho-ZYX (S142). Recognizes Phospho-ZYX (S142) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000
    ZYX Recombinant Protein (Rat)
    RP238847 100 ug Ask for price
    ZYX Recombinant Protein (Mouse)
    RP188411 100 ug Ask for price
    ZYX sgRNA CRISPR Lentivector set (Human)
    K2744501 3 x 1.0 ug
    EUR 339
    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9
    CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV100PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV105PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV120PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV125PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS700A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS720A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
    CAS740A-KIT 10 rxn
    EUR 1132
    • Category: Cas9
    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9
    Zyxin (Phospho-Tyr316) Conjugated Antibody
    C13247 100ul
    EUR 397
    Zyxin (Phospho-Ser143) Conjugated Antibody
    C13248 100ul
    EUR 397
    Phospho-Zyxin (Tyr316) Blocking Peptide
    AF7402-BP 1mg
    EUR 195
    Phospho-Zyxin (Ser143) Blocking Peptide
    AF7403-BP 1mg
    EUR 195
    Zyxin (phospho Ser142) Polyclonal Antibody
    ES7554-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Zyxin (phospho Ser142) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
    Zyxin (phospho Ser142) Polyclonal Antibody
    ES7554-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Zyxin (phospho Ser142) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
    Zyxin (phospho Ser142) Polyclonal Antibody
    ABP56555-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from human Zyxin around the phosphorylation site of S142
    • Applications tips:
    Description: A polyclonal antibody for detection of Zyxin phospho Ser142) from Human. This Zyxin phospho Ser142) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Zyxin around the phosphorylation site of S142
    Zyxin (phospho Ser142) Polyclonal Antibody
    ABP56555-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from human Zyxin around the phosphorylation site of S142
    • Applications tips:
    Description: A polyclonal antibody for detection of Zyxin phospho Ser142) from Human. This Zyxin phospho Ser142) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Zyxin around the phosphorylation site of S142
    Zyxin (phospho Ser142) Polyclonal Antibody
    ABP56555-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from human Zyxin around the phosphorylation site of S142
    • Applications tips:
    Description: A polyclonal antibody for detection of Zyxin phospho Ser142) from Human. This Zyxin phospho Ser142) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Zyxin around the phosphorylation site of S142
    Phospho- Zyxin (Ser142/143) Antibody
    ABF3801 100 ug
    EUR 438
    CFP-Zyxin fusion Lentiviral particles
    LVP449-C 1x107 IFU/ml x 200ul
    EUR 451
    Description: Pre-made lentiviral particles expressing (CFP-human Zyxin) fusion contruct under suCMV promoter, provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.
    GFP-Zyxin fusion Lentiviral particles
    LVP449-G 1x107 IFU/ml x 200ul
    EUR 451
    Description: Pre-made lentiviral particles expressing (GFP-human Zyxin) fusion contruct under suCMV promoter, provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.
    RFP-Zyxin fusion Lentiviral particles
    LVP449-R 1x107 IFU/ml x 200ul
    EUR 451
    Description: Pre-made lentiviral particles expressing (RFP-human Zyxin) fusion contruct under suCMV promoter, provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.
    Anti-Phospho-Zyxin (S142) antibody
    STJ90641 200 µl
    EUR 197
    Description: Rabbit polyclonal to Phospho-Zyxin (S142).
    Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV200PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV205PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV220PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
    CASLV225PA-KIT 1 Kit
    EUR 1132
    • Category: Cas9
    Recombinant Human Zyxin Protein, His, Mammal-100ug
    QP10108-ma-100ug 100ug
    EUR 1178
    Recombinant Human Zyxin Protein, His, Mammal-20ug
    QP10108-ma-20ug 20ug
    EUR 462
    Recombinant Human Zyxin Protein, His, Mammal-50ug
    QP10108-ma-50ug 50ug
    EUR 862
    Polyclonal Goat Anti-ZYX Antibody
    APR12197G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-ZYX . This antibody is tested and proven to work in the following applications:
    Zyx ORF Vector (Rat) (pORF)
    ORF079617 1.0 ug DNA
    EUR 506
    Zyx ORF Vector (Mouse) (pORF)
    ORF062805 1.0 ug DNA
    EUR 506