Human RAB7A(RAB7A, Member RAS Oncogene Family) ELISA Kit

Human RAB7A(RAB7A, Member RAS Oncogene Family) ELISA Kit

To Order Contact us: 

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
RD-RAB7A-Hu-96Tests 96 Tests
EUR 723
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
abx117042-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
20-abx127026
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
abx122528-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
abx237043-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
20-abx302116
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
20-abx000788
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
20-abx001068
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
20-abx156866
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human RAB7A, Member RAS Oncogene Family ELISA Kit (RAB7A)
RK02178 96 Tests
EUR 521
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
SEK300Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
SEK300Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
SEK300Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
SEK300Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.
Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
4-SEK300Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB7A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB7
  • Ras-related protein Rab-7a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human RAB7A, Member RAS Oncogene Family (RAB7A) CLIA Kit
20-abx495849
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (HRP)
20-abx314287
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (FITC)
20-abx314288
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (Biotin)
20-abx314289
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ELISA kit for Human RAB7A (RAB7A, Member RAS Oncogene Family)
ELK5152 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB7A, Member RAS Oncogene Family (RAB7A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of RAB7A, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
RAB7A, Member RAS Oncogene Family Protein
20-abx260842
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
Recombinant Human RAB7A, Member RAS Oncogene Family
7-06004 5µg Ask for price
Recombinant Human RAB7A, Member RAS Oncogene Family
7-06005 20µg Ask for price
Recombinant Human RAB7A, Member RAS Oncogene Family
7-06006 1mg Ask for price
RAB7A, Member RAS Oncogene Family Human Recombinant Protein
PROTP51149 Regular: 20ug
EUR 317
Description: RAB7A produced in E.Coli is a single, non-glycosylated polypeptide chain containing 227 amino acids (1-207a.a.) and having a molecular mass of 25.6kDa.;RAB7A is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Rab7a/ Rat Rab7a ELISA Kit
ELI-44430r 96 Tests
EUR 886
RAB7A ELISA KIT|Human
EF002258 96 Tests
EUR 689
RAB7A antibody
38205-100ul 100ul
EUR 252
RAB7A Antibody
DF6288 200ul
EUR 304
Description: RAB7A Antibody detects endogenous levels of total RAB7A.
RAB7A Antibody
CSB-PA019219KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
RAB7A Antibody
CSB-PA019219KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
RAB7A Antibody
1-CSB-PA019219LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
RAB7A siRNA
20-abx904434
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAB7A siRNA
20-abx930704
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAB7A siRNA
20-abx930705
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
RAB7A Antibody
ABD6288 100 ug
EUR 438
EGFP- Rab7A
PVT10344 2 ug
EUR 266
anti-RAB7A
YF-PA15488 100 ug
EUR 403
Description: Rabbit polyclonal to RAB7A
Canine RAB7A ELISA KIT
ELI-44429d 96 Tests
EUR 928
Human RAB7A/ Ras-related protein Rab-7a ELISA Kit
E2947Hu 1 Kit
EUR 605
Human Ras- related protein Rab- 7a, RAB7A ELISA KIT
ELI-36110h 96 Tests
EUR 824
Rabbit Ras- related protein Rab- 7a, RAB7A ELISA KIT
ELI-18192Ra 96 Tests
EUR 928
Bovine Ras- related protein Rab- 7a, RAB7A ELISA KIT
ELI-22150b 96 Tests
EUR 928
Mouse Ras- related protein Rab- 7a, Rab7a ELISA KIT
ELI-30429m 96 Tests
EUR 865
RAB7A Rabbit pAb
A1154-100ul 100 ul
EUR 308
RAB7A Rabbit pAb
A1154-200ul 200 ul
EUR 459
RAB7A Rabbit pAb
A1154-20ul 20 ul
EUR 183
RAB7A Rabbit pAb
A1154-50ul 50 ul
EUR 223
RAB7A Rabbit pAb
A12344-100ul 100 ul
EUR 308
RAB7A Rabbit pAb
A12344-200ul 200 ul
EUR 459
RAB7A Rabbit pAb
A12344-20ul 20 ul Ask for price
RAB7A Rabbit pAb
A12344-50ul 50 ul Ask for price
RAB7A Rabbit pAb
A12784-100ul 100 ul
EUR 308
RAB7A Rabbit pAb
A12784-200ul 200 ul
EUR 459
RAB7A Rabbit pAb
A12784-20ul 20 ul
EUR 183
RAB7A Rabbit pAb
A12784-50ul 50 ul
EUR 223
RAB7A Blocking Peptide
DF6288-BP 1mg
EUR 195
RAB7A Conjugated Antibody
C38205 100ul
EUR 397
RAB7A cloning plasmid
CSB-CL019219HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 696
  • Sequence: atgagtttctcatccaggccagtccccgagatcctgaaaacttcccatttgttgtgttgggaaacaagattgacctcgaaaacagacaagtggccacaaagcgggcacaggcctggtgctacagcaaaaacaacattccctactttgagaccagtgccaaggaggccatcaacgtg
  • Show more
Description: A cloning plasmid for the RAB7A gene.
anti- RAB7A antibody
FNab07043 100µg
EUR 505.25
  • Immunogen: RAB7A, member RAS oncogene family
  • Uniprot ID: P51149
  • Gene ID: 7879
  • Research Area: Signal Transduction
Description: Antibody raised against RAB7A
Anti-RAB7A antibody
PAab07043 100 ug
EUR 355
pENTR223- RAB7A- T8G
PVT11507 2 ug
EUR 273
pCMV-SPORT6-RAB7A
PVT13684 2 ug
EUR 391
EGFP-Rab7A Q67L
PVT17461 2 ug
EUR 300
Anti-RAB7A antibody
STJ25267 100 µl
EUR 277
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.
Anti-RAB7A antibody
STJ114224 100 µl
EUR 277
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.
Anti-RAB7A antibody
STJ114654 100 µl
EUR 277
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.
Anti-Rab7a antibody
STJ140063 150 µg
EUR 231
Description: Goat polyclonal antibody to mouse Rab7. Rab7 belongs to the small GTPase superfamily, Rab family. It has been localized to late endosomes, regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. Rab7 also contributes to the maturation of phagosomes (acidification).
Human RAB7A shRNA Plasmid
20-abx955306
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
RAB7A Recombinant Protein (Human)
RP025543 100 ug Ask for price
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
DLR-RAB1A-Hu-48T 48T
EUR 517
  • Should the Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from tissue homogenates or other biological fluids.
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
DLR-RAB1A-Hu-96T 96T
EUR 673
  • Should the Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from tissue homogenates or other biological fluids.
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
DLR-RAB37-Hu-48T 48T
EUR 554
  • Should the Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from tissue homogenates or other biological fluids.
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
DLR-RAB37-Hu-96T 96T
EUR 725
  • Should the Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from tissue homogenates or other biological fluids.
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
DLR-RAB5A-Hu-48T 48T
EUR 517
  • Should the Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from tissue homogenates or other biological fluids.
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
DLR-RAB5A-Hu-96T 96T
EUR 673
  • Should the Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from tissue homogenates or other biological fluids.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
DLR-RAB5C-Hu-48T 48T
EUR 554
  • Should the Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
DLR-RAB5C-Hu-96T 96T
EUR 725
  • Should the Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
DLR-RAB8B-Hu-48T 48T
EUR 517
  • Should the Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB8B, Member RAS Oncogene Family (RAB8B) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
DLR-RAB8B-Hu-96T 96T
EUR 673
  • Should the Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB8B, Member RAS Oncogene Family (RAB8B) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
20-abx152910
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
20-abx152911
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
20-abx152912
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
20-abx258183
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.
Human RAB27B, Member RAS Oncogene Family (RAB27B) ELISA Kit
20-abx382610
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
20-abx382639
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
20-abx585081
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Human RAB5A, Member RAS Oncogene Family(RAB5A)ELISA Kit
QY-E04663 96T
EUR 361
Human RAB37, Member RAS Oncogene Family(RAB37) ELISA Kit
QY-E04664 96T
EUR 361
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
RDR-RAB1A-Hu-48Tests 48 Tests
EUR 544
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
RDR-RAB1A-Hu-96Tests 96 Tests
EUR 756
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
RDR-RAB37-Hu-48Tests 48 Tests
EUR 589
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
RDR-RAB37-Hu-96Tests 96 Tests
EUR 820
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
RDR-RAB5A-Hu-48Tests 48 Tests
EUR 544
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
RDR-RAB5A-Hu-96Tests 96 Tests
EUR 756
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
RDR-RAB5C-Hu-48Tests 48 Tests
EUR 589
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
RDR-RAB5C-Hu-96Tests 96 Tests
EUR 820
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
RDR-RAB8B-Hu-48Tests 48 Tests
EUR 544
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
RDR-RAB8B-Hu-96Tests 96 Tests
EUR 756
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
RD-RAB1A-Hu-48Tests 48 Tests
EUR 521
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
RD-RAB1A-Hu-96Tests 96 Tests
EUR 723
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
RD-RAB37-Hu-48Tests 48 Tests
EUR 563
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
RD-RAB37-Hu-96Tests 96 Tests
EUR 783
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
RD-RAB5A-Hu-48Tests 48 Tests
EUR 521
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
RD-RAB5A-Hu-96Tests 96 Tests
EUR 723
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
RD-RAB5C-Hu-48Tests 48 Tests
EUR 563
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
RD-RAB5C-Hu-96Tests 96 Tests
EUR 783
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
RD-RAB8B-Hu-48Tests 48 Tests
EUR 521
Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
RD-RAB8B-Hu-96Tests 96 Tests
EUR 723
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
SEP757Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
4-SEP757Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB5C, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RABL
  • RAB5CL
  • Ras-related protein Rab-5C
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
SEJ783Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.
Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
4-SEJ783Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1
  • YPT1
  • Ras-related protein Rab-1A
  • YPT1-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
SEK305Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
SEK305Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
SEK305Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
SEK305Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.
Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
4-SEK305Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB5A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB5
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
SEM679Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
SEM679Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
SEM679Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
SEM679Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.
Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
4-SEM679Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB37, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: Ras-related protein Rab-37
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
Rab10, Member Ras Oncogene Family Antibody
20-abx114958
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab11A, Member Ras Oncogene Family Antibody
20-abx114961
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab12, Member Ras Oncogene Family Antibody
20-abx114963
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab14, Member Ras Oncogene Family Antibody
20-abx114964
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab1A, Member Ras Oncogene Family Antibody
20-abx114967
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab32, Member Ras Oncogene Family Antibody
20-abx114980
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab39, Member Ras Oncogene Family Antibody
20-abx114985
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab3B, Member Ras Oncogene Family Antibody
20-abx114990
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab43, Member Ras Oncogene Family Antibody
20-abx114995
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab4A, Member Ras Oncogene Family Antibody
20-abx114996
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab5B, Member Ras Oncogene Family Antibody
20-abx114998
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab7B, Member Ras Oncogene Family Antibody
20-abx115001
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab8A, Member Ras Oncogene Family Antibody
20-abx115002
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Rab9B, Member Ras Oncogene Family Antibody
20-abx115006
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
RAP2B, Member RAS Oncogene Family Antibody
20-abx137206
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB27A, Member RAS Oncogene Family Protein
20-abx260595
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB11A, Member RAS Oncogene Family Protein
20-abx260596
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB5B, Member RAS Oncogene Family Protein
20-abx260830
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB27B, Member RAS Oncogene Family Protein
20-abx260840
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB2B, Member RAS Oncogene Family Protein
20-abx260852
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB6B, Member RAS Oncogene Family Protein
20-abx260859
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB31, Member RAS Oncogene Family Protein
20-abx260886
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAP2B, Member RAS Oncogene Family Protein
20-abx261020
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB5C, Member RAS Oncogene Family Protein
20-abx261048
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB3D, Member RAS Oncogene Family Protein
20-abx261384
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB17, Member RAS Oncogene Family Protein
20-abx261460
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB3B, Member RAS Oncogene Family Protein
20-abx261461
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB32, Member RAS Oncogene Family Protein
20-abx261507
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB24, Member RAS Oncogene Family Protein
20-abx261508
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB23, Member RAS Oncogene Family Protein
20-abx261518
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB2A, Member RAS Oncogene Family Protein
20-abx261972
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB5A, Member RAS Oncogene Family Protein
20-abx261995
  • EUR 4490.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB22, Member RAS Oncogene Family Protein
20-abx263453
  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.
RAB1B, Member RAS Oncogene Family Protein
20-abx262456
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RAB6A, Member RAS Oncogene Family Protein
20-abx262458
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RAP2A, Member RAS Oncogene Family Protein
20-abx262464
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RAP1B, Member RAS Oncogene Family Protein
20-abx262469
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RAB1A, Member RAS Oncogene Family Protein
20-abx262476
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RAB21, Member RAS Oncogene Family Protein
20-abx262484
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RAB10, Member RAS Oncogene Family Protein
20-abx262581
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RAP1A, Member RAS Oncogene Family Protein
20-abx262895
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RAB3A, Member RAS Oncogene Family Protein
20-abx262903
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RAB4A, Member RAS Oncogene Family Protein
20-abx262904
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RAB14, Member RAS Oncogene Family Protein
20-abx262905
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.
RAB13, Member RAS Oncogene Family Protein
20-abx262907
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.