Human RAB7A(RAB7A, Member RAS Oncogene Family) ELISA Kit

Human RAB7A(RAB7A, Member RAS Oncogene Family) ELISA Kit

To Order Contact us: 

    Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
    RD-RAB7A-Hu-96Tests 96 Tests
    EUR 723
    RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
    abx117042-100ug 100 ug
    EUR 467
    • Shipped within 5-10 working days.
    RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.
    RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
    abx122528-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
    abx237043-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
    • EUR 495.00
    • EUR 356.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    RAB7A, Member RAS Oncogene Family (RAB7A) Antibody
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human RAB7A, Member RAS Oncogene Family ELISA Kit (RAB7A)
    RK02178 96 Tests
    EUR 521
    Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
    SEK300Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.
    Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
    SEK300Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.
    Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
    SEK300Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.
    Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
    SEK300Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.
    Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as RAB7A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB7
    • Ras-related protein Rab-7a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human RAB7A, Member RAS Oncogene Family (RAB7A) CLIA Kit
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (HRP)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (FITC)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (Biotin)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    ELISA kit for Human RAB7A (RAB7A, Member RAS Oncogene Family)
    ELK5152 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB7A, Member RAS Oncogene Family (RAB7A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
    • Show more
    Description: A sandwich ELISA kit for detection of RAB7A, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
    RAB7A, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    Recombinant Human RAB7A, Member RAS Oncogene Family
    7-06004 5µg Ask for price
    Recombinant Human RAB7A, Member RAS Oncogene Family
    7-06005 20µg Ask for price
    Recombinant Human RAB7A, Member RAS Oncogene Family
    7-06006 1mg Ask for price
    RAB7A, Member RAS Oncogene Family Human Recombinant Protein
    PROTP51149 Regular: 20ug
    EUR 317
    Description: RAB7A produced in E.Coli is a single, non-glycosylated polypeptide chain containing 227 amino acids (1-207a.a.) and having a molecular mass of 25.6kDa.;RAB7A is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
    Rab7a/ Rat Rab7a ELISA Kit
    ELI-44430r 96 Tests
    EUR 886
    EF002258 96 Tests
    EUR 689
    RAB7A antibody
    38205-100ul 100ul
    EUR 252
    RAB7A Antibody
    DF6288 200ul
    EUR 304
    Description: RAB7A Antibody detects endogenous levels of total RAB7A.
    RAB7A Antibody
    EUR 335
    • Form: liquid
    • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
    Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
    RAB7A Antibody
    CSB-PA019219KA01HU-100ul 100ul
    EUR 389
    • Form: liquid
    • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
    Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
    RAB7A Antibody
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
    RAB7A siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RAB7A siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RAB7A siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RAB7A Antibody
    ABD6288 100 ug
    EUR 438
    EGFP- Rab7A
    PVT10344 2 ug
    EUR 266
    YF-PA15488 100 ug
    EUR 403
    Description: Rabbit polyclonal to RAB7A
    Canine RAB7A ELISA KIT
    ELI-44429d 96 Tests
    EUR 928
    Human RAB7A/ Ras-related protein Rab-7a ELISA Kit
    E2947Hu 1 Kit
    EUR 605
    Human Ras- related protein Rab- 7a, RAB7A ELISA KIT
    ELI-36110h 96 Tests
    EUR 824
    RAB7A ELISA Kit (Human) (OKCD02032)
    OKCD02032 96 Wells
    EUR 831
    Description: Description of target: Key regulator in endo-lysosomal trafficking. Governs early-to-late endosomal maturation, microtubule minus-end as well as plus-end directed endosomal migration and positioning, and endosome-lysosome transport through different protein-protein interaction cascades. Plays a central role, not only in endosomal traffic, but also in many other cellular and physiological events, such as growth-factor-mediated cell signaling, nutrient-transportor mediated nutrient uptake, neurotrophin transport in the axons of neurons and lipid metabolism. Also involved in regulation of some specialized endosomal membrane trafficking, such as maturation of melanosomes, pathogen-induced phagosomes (or vacuoles) and autophagosomes. Plays a role in the maturation and acidification of phagosomes that engulf pathogens, such as S.aureus and M.tuberculosis. Plays a role in the fusion of phagosomes with lysosomes. Plays important roles in microbial pathogen infection and survival, as well as in participating in the life cycle of viruses. Microbial pathogens possess survival strategies governed by RAB7A, sometimes by employing RAB7A function (e.g. Salmonella) and sometimes by excluding RAB7A function (e.g. Mycobacterium). In concert with RAC1, plays a role in regulating the formation of RBs (ruffled borders) in osteoclasts. Controls the endosomal trafficking and neurite outgrowth signaling of NTRK1/TRKA.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL
    RAB7A ELISA Kit (Human) (OKEH08041)
    OKEH08041 96 Wells
    EUR 896
    Description: Description of target: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23ng/mL
    Rabbit Ras- related protein Rab- 7a, RAB7A ELISA KIT
    ELI-18192Ra 96 Tests
    EUR 928
    Bovine Ras- related protein Rab- 7a, RAB7A ELISA KIT
    ELI-22150b 96 Tests
    EUR 928
    Mouse Ras- related protein Rab- 7a, Rab7a ELISA KIT
    ELI-30429m 96 Tests
    EUR 865
    RAB7A Rabbit pAb
    A1154-100ul 100 ul
    EUR 308
    RAB7A Rabbit pAb
    A1154-200ul 200 ul
    EUR 459
    RAB7A Rabbit pAb
    A1154-20ul 20 ul
    EUR 183
    RAB7A Rabbit pAb
    A1154-50ul 50 ul
    EUR 223
    RAB7A Rabbit pAb
    A12344-100ul 100 ul
    EUR 308
    RAB7A Rabbit pAb
    A12344-200ul 200 ul
    EUR 459
    RAB7A Rabbit pAb
    A12344-20ul 20 ul Ask for price
    RAB7A Rabbit pAb
    A12344-50ul 50 ul Ask for price
    RAB7A Rabbit pAb
    A12784-100ul 100 ul
    EUR 308
    RAB7A Rabbit pAb
    A12784-200ul 200 ul
    EUR 459
    RAB7A Rabbit pAb
    A12784-20ul 20 ul
    EUR 183
    RAB7A Rabbit pAb
    A12784-50ul 50 ul
    EUR 223
    RAB7A Blocking Peptide
    DF6288-BP 1mg
    EUR 195
    RAB7A Conjugated Antibody
    C38205 100ul
    EUR 397
    RAB7A cloning plasmid
    CSB-CL019219HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 696
    • Sequence: atgagtttctcatccaggccagtccccgagatcctgaaaacttcccatttgttgtgttgggaaacaagattgacctcgaaaacagacaagtggccacaaagcgggcacaggcctggtgctacagcaaaaacaacattccctactttgagaccagtgccaaggaggccatcaacgtg
    • Show more
    Description: A cloning plasmid for the RAB7A gene.
    anti- RAB7A antibody
    FNab07043 100µg
    EUR 505.25
    • Immunogen: RAB7A, member RAS oncogene family
    • Uniprot ID: P51149
    • Gene ID: 7879
    • Research Area: Signal Transduction
    Description: Antibody raised against RAB7A
    Anti-RAB7A antibody
    PAab07043 100 ug
    EUR 355
    pENTR223- RAB7A- T8G
    PVT11507 2 ug
    EUR 273
    PVT13684 2 ug
    EUR 391
    EGFP-Rab7A Q67L
    PVT17461 2 ug
    EUR 300
    Anti-RAB7A antibody
    STJ25267 100 µl
    EUR 277
    Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.
    Anti-RAB7A antibody
    STJ114224 100 µl
    EUR 277
    Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.
    Anti-RAB7A antibody
    STJ114654 100 µl
    EUR 277
    Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.
    Anti-Rab7a antibody
    STJ140063 150 µg
    EUR 231
    Description: Goat polyclonal antibody to mouse Rab7. Rab7 belongs to the small GTPase superfamily, Rab family. It has been localized to late endosomes, regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. Rab7 also contributes to the maturation of phagosomes (acidification).
    Human RAB7A shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    RAB7A Recombinant Protein (Human)
    RP025543 100 ug Ask for price
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    DLR-RAB1A-Hu-48T 48T
    EUR 517
    • Should the Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from tissue homogenates or other biological fluids.
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    DLR-RAB1A-Hu-96T 96T
    EUR 673
    • Should the Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from tissue homogenates or other biological fluids.
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    DLR-RAB37-Hu-48T 48T
    EUR 554
    • Should the Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from tissue homogenates or other biological fluids.
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    DLR-RAB37-Hu-96T 96T
    EUR 725
    • Should the Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from tissue homogenates or other biological fluids.
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    DLR-RAB5A-Hu-48T 48T
    EUR 517
    • Should the Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from tissue homogenates or other biological fluids.
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    DLR-RAB5A-Hu-96T 96T
    EUR 673
    • Should the Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from tissue homogenates or other biological fluids.
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    DLR-RAB5C-Hu-48T 48T
    EUR 554
    • Should the Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    DLR-RAB5C-Hu-96T 96T
    EUR 725
    • Should the Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
    DLR-RAB8B-Hu-48T 48T
    EUR 517
    • Should the Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human RAB8B, Member RAS Oncogene Family (RAB8B) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
    DLR-RAB8B-Hu-96T 96T
    EUR 673
    • Should the Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human RAB8B, Member RAS Oncogene Family (RAB8B) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human RAB27B, Member RAS Oncogene Family (RAB27B) ELISA Kit
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.
    Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.
    Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.
    Human RAB5A, Member RAS Oncogene Family(RAB5A)ELISA Kit
    QY-E04663 96T
    EUR 361
    Human RAB37, Member RAS Oncogene Family(RAB37) ELISA Kit
    QY-E04664 96T
    EUR 361
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    RDR-RAB1A-Hu-48Tests 48 Tests
    EUR 544
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    RDR-RAB1A-Hu-96Tests 96 Tests
    EUR 756
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    RDR-RAB37-Hu-48Tests 48 Tests
    EUR 589
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    RDR-RAB37-Hu-96Tests 96 Tests
    EUR 820
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    RDR-RAB5A-Hu-48Tests 48 Tests
    EUR 544
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    RDR-RAB5A-Hu-96Tests 96 Tests
    EUR 756
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    RDR-RAB5C-Hu-48Tests 48 Tests
    EUR 589
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    RDR-RAB5C-Hu-96Tests 96 Tests
    EUR 820
    Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
    RDR-RAB8B-Hu-48Tests 48 Tests
    EUR 544
    Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
    RDR-RAB8B-Hu-96Tests 96 Tests
    EUR 756
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    RD-RAB1A-Hu-48Tests 48 Tests
    EUR 521
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    RD-RAB1A-Hu-96Tests 96 Tests
    EUR 723
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    RD-RAB37-Hu-48Tests 48 Tests
    EUR 563
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    RD-RAB37-Hu-96Tests 96 Tests
    EUR 783
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    RD-RAB5A-Hu-48Tests 48 Tests
    EUR 521
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    RD-RAB5A-Hu-96Tests 96 Tests
    EUR 723
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    RD-RAB5C-Hu-48Tests 48 Tests
    EUR 563
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    RD-RAB5C-Hu-96Tests 96 Tests
    EUR 783
    Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
    RD-RAB8B-Hu-48Tests 48 Tests
    EUR 521
    Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit
    RD-RAB8B-Hu-96Tests 96 Tests
    EUR 723
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    SEP757Hu-10x96wellstestplate 10x96-wells test plate
    EUR 5189.65
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    SEP757Hu-1x48wellstestplate 1x48-wells test plate
    EUR 515.03
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    SEP757Hu-1x96wellstestplate 1x96-wells test plate
    EUR 692.9
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    SEP757Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2818.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5C, Member RAS Oncogene Family (RAB5C) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in serum, plasma, tissue homogenates and other biological fluids.
    Human RAB5C, Member RAS Oncogene Family (RAB5C) ELISA Kit
    • EUR 5240.00
    • EUR 2769.00
    • EUR 693.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as RAB5C, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RABL
    • RAB5CL
    • Ras-related protein Rab-5C
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB5C, Member RAS Oncogene Family (RAB5C) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    SEJ783Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    SEJ783Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    SEJ783Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    SEJ783Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB1A, Member RAS Oncogene Family (RAB1A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in Tissue homogenates and other biological fluids.
    Human RAB1A, Member RAS Oncogene Family (RAB1A) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as RAB1A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB1
    • YPT1
    • Ras-related protein Rab-1A
    • YPT1-related protein
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB1A, Member RAS Oncogene Family (RAB1A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    SEK305Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    SEK305Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    SEK305Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    SEK305Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB5A, Member RAS Oncogene Family (RAB5A) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in Tissue homogenates and other biological fluids.
    Human RAB5A, Member RAS Oncogene Family (RAB5A) ELISA Kit
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as RAB5A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB5
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB5A, Member RAS Oncogene Family (RAB5A) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    SEM679Hu-10x96wellstestplate 10x96-wells test plate
    EUR 5189.65
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    SEM679Hu-1x48wellstestplate 1x48-wells test plate
    EUR 515.03
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    SEM679Hu-1x96wellstestplate 1x96-wells test plate
    EUR 692.9
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    SEM679Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2818.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB37, Member RAS Oncogene Family (RAB37) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-A
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in Tissue homogenates and other biological fluids.
    Human RAB37, Member RAS Oncogene Family (RAB37) ELISA Kit
    • EUR 5240.00
    • EUR 2769.00
    • EUR 693.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as RAB37, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: Ras-related protein Rab-37
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB37, Member RAS Oncogene Family (RAB37) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
    Rab10, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab11A, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab12, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab14, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab1A, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab32, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab39, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab3B, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab43, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab4A, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab5B, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab7B, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab8A, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rab9B, Member Ras Oncogene Family Antibody
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    RAP2B, Member RAS Oncogene Family Antibody
    • EUR 704.00
    • EUR 328.00
    • EUR 230.00
    • 100 ug
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB27A, Member RAS Oncogene Family Protein
    • EUR 2861.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 25 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB11A, Member RAS Oncogene Family Protein
    • EUR 2861.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 25 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB5B, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB27B, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB2B, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB6B, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB31, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAP2B, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB5C, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB3D, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB17, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB3B, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB32, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB24, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB23, Member RAS Oncogene Family Protein
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB2A, Member RAS Oncogene Family Protein
    • EUR 4490.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB5A, Member RAS Oncogene Family Protein
    • EUR 4490.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB22, Member RAS Oncogene Family Protein
    • EUR 230.00
    • EUR 1609.00
    • EUR 328.00
    • 1 µg
    • 50 ug
    • 5 ug
    • Shipped within 5-10 working days.
    RAB1B, Member RAS Oncogene Family Protein
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.
    RAB6A, Member RAS Oncogene Family Protein
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.
    RAP2A, Member RAS Oncogene Family Protein
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.
    RAP1B, Member RAS Oncogene Family Protein
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.
    RAB1A, Member RAS Oncogene Family Protein
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.
    RAB21, Member RAS Oncogene Family Protein
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.
    RAB10, Member RAS Oncogene Family Protein
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.
    RAP1A, Member RAS Oncogene Family Protein
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.
    RAB3A, Member RAS Oncogene Family Protein
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.
    RAB4A, Member RAS Oncogene Family Protein
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.