Human PRM1(Protamine 1) ELISA Kit

Human PRM1(Protamine 1) ELISA Kit

To Order Contact us: 

    Human Protamine 1 (PRM1) ELISA Kit

    RD-PRM1-Hu-96Tests 96 Tests
    EUR 723

    Human Protamine 1 (PRM1) ELISA Kit

    RDR-PRM1-Hu-48Tests 48 Tests
    EUR 544

    Human Protamine 1 (PRM1) ELISA Kit

    RDR-PRM1-Hu-96Tests 96 Tests
    EUR 756

    Human Protamine 1(PRM1)ELISA Kit

    GA-E1181HM-48T 48T
    EUR 289

    Human Protamine 1(PRM1)ELISA Kit

    GA-E1181HM-96T 96T
    EUR 466

    Human Protamine 1 (PRM1) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Protamine 1,PRM1 ELISA Kit

    201-12-1165 96 tests
    EUR 440
    • This Protamine 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Protamine 1, PRM1 ELISA Kit

    CSB-E09630h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Protamine 1, PRM1 in samples from serum, plasma. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Protamine 1, PRM1 ELISA Kit

    • EUR 900.00
    • EUR 5476.00
    • EUR 2900.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Protamine 1, PRM1 in samples from serum, plasma. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Protamine 1(PRM1)ELISA Kit

    QY-E00394 96T
    EUR 361

    Human Protamine 1 (PRM1) ELISA Kit

    SEH308Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Protamine 1 (PRM1) ELISA Kit

    SEH308Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Protamine 1 (PRM1) ELISA Kit

    SEH308Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Protamine 1 (PRM1) ELISA Kit

    SEH308Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 1 (PRM1) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 1 (PRM1) in Tissue homogenates, cell lysates and other biological fluids.

    Human Protamine 1 (PRM1) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Protamine 1 elisa. Alternative names of the recognized antigen: CT94.1
    • Cancer/Testis Antigen Family 94, Member 1
    • Sperm protamine P1
    • Cysteine-rich protamine
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protamine 1 (PRM1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Protamine 1 (PRM1) Antibody

    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Protamine 1 (PRM1) Antibody

    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Recombinant Protamine 1 (PRM1)

    • EUR 449.44
    • EUR 223.00
    • EUR 1410.40
    • EUR 536.80
    • EUR 973.60
    • EUR 364.00
    • EUR 3376.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P04553
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 10.4kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Protamine 1 expressed in: E.coli

    ELISA kit for Human PRM1 (Protamine 1)

    ELK4763 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protamine 1 (PRM1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protamine 1 (PR
    • Show more
    Description: A sandwich ELISA kit for detection of Protamine 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Protamine-1 (PRM1)

    KTE61141-48T 48T
    EUR 354
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protamine-1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Protamine-1 (PRM1)

    KTE61141-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protamine-1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Protamine-1 (PRM1)

    KTE61141-96T 96T
    EUR 572
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protamine-1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Human Protamine 1 (PRM1) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Protamine 1 (PRM1) Protein

    • EUR 634.00
    • EUR 272.00
    • EUR 1901.00
    • EUR 746.00
    • EUR 453.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Protamine 1 (PRM1) Polyclonal Antibody (Human)

    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PRM1 (Ala2~His51)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1)

    Human PRM1/ Sperm protamine P1 ELISA Kit

    E2044Hu 1 Kit
    EUR 571

    Human PRM1(Sperm protamine P1) ELISA Kit

    EH1561 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P04553
    • Alias: PRM1/Sperm protamine P1/Cysteine-rich protamine
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Human Sperm protamine P1, PRM1 ELISA KIT

    ELI-04584h 96 Tests
    EUR 824

    Human Sperm protamine P1 (PRM1) ELISA Kit

    abx250850-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Protamine 1 (PRM1) Polyclonal Antibody (Human), APC

    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PRM1 (Ala2~His51)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with APC.

    Protamine 1 (PRM1) Polyclonal Antibody (Human), Biotinylated

    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PRM1 (Ala2~His51)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with Biotin.

    Protamine 1 (PRM1) Polyclonal Antibody (Human), Cy3

    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PRM1 (Ala2~His51)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with Cy3.

    Protamine 1 (PRM1) Polyclonal Antibody (Human), FITC

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PRM1 (Ala2~His51)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with FITC.

    Protamine 1 (PRM1) Polyclonal Antibody (Human), HRP

    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PRM1 (Ala2~His51)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with HRP.

    Protamine 1 (PRM1) Polyclonal Antibody (Human), PE

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PRM1 (Ala2~His51)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with PE.

    Cow Sperm protamine P1 (PRM1) ELISA Kit

    abx516736-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Sperm protamine P1 (PRM1) ELISA Kit

    abx516738-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Pig Sperm protamine P1 (PRM1) ELISA Kit

    abx516739-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Rat Sperm protamine P1 (PRM1) ELISA Kit

    abx516740-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Rat Prm1/ Sperm protamine P1 ELISA Kit

    E0803Ra 1 Kit
    EUR 571

    Mouse Sperm protamine P1, Prm1 ELISA KIT

    ELI-04579m 96 Tests
    EUR 865

    Rat Sperm protamine P1, Prm1 ELISA KIT

    ELI-04580r 96 Tests
    EUR 886

    Porcine Sperm protamine P1, PRM1 ELISA KIT

    ELI-04581p 96 Tests
    EUR 928

    Rabbit Sperm protamine P1, PRM1 ELISA KIT

    ELI-04582Ra 96 Tests
    EUR 928

    Bovine Sperm protamine P1, PRM1 ELISA KIT

    ELI-04583b 96 Tests
    EUR 928

    Protamine 1 (PRM1) Polyclonal Antibody (Human), APC-Cy7

    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PRM1 (Ala2~His51)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Protamine 1 (PRM1). This antibody is labeled with APC-Cy7.

    ELISA kit for Pig Sperm protamine P1 (PRM1)

    KTE80069-48T 48T
    EUR 354
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Pig Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Pig Sperm protamine P1 (PRM1)

    KTE80069-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Pig Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Pig Sperm protamine P1 (PRM1)

    KTE80069-96T 96T
    EUR 572
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Pig Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rabbit Sperm protamine P1 (PRM1)

    KTE90125-48T 48T
    EUR 354
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rabbit Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rabbit Sperm protamine P1 (PRM1)

    KTE90125-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rabbit Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rabbit Sperm protamine P1 (PRM1)

    KTE90125-96T 96T
    EUR 572
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rabbit Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Sperm protamine P1 (PRM1)

    KTE100422-48T 48T
    EUR 332
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Sperm protamine P1 (PRM1)

    KTE100422-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Sperm protamine P1 (PRM1)

    KTE100422-96T 96T
    EUR 539
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Bovine Sperm protamine P1 (PRM1)

    KTE10176-48T 48T
    EUR 354
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Bovine Sperm protamine P1 (PRM1)

    KTE10176-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Bovine Sperm protamine P1 (PRM1)

    KTE10176-96T 96T
    EUR 572
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Sheep Sperm protamine P1 (PRM1)

    KTE110021-48T 48T
    EUR 354
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Sheep Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Sheep Sperm protamine P1 (PRM1)

    KTE110021-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Sheep Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Sheep Sperm protamine P1 (PRM1)

    KTE110021-96T 96T
    EUR 572
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Sheep Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Goat Sperm protamine P1 (PRM1)

    KTE50010-48T 48T
    EUR 354
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Goat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Goat Sperm protamine P1 (PRM1)

    KTE50010-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Goat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Goat Sperm protamine P1 (PRM1)

    KTE50010-96T 96T
    EUR 572
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Goat Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Sperm protamine P1 (PRM1)

    KTE70661-48T 48T
    EUR 332
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Sperm protamine P1 (PRM1)

    KTE70661-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Sperm protamine P1 (PRM1)

    KTE70661-96T 96T
    EUR 539
    • Protamines are small, arginine-rich, nuclear proteins that replace histones late in the haploid phase of spermatogenesis and are believed essential for sperm head condensation and DNA stabilization. Mice, humans, and certain fish have 2 or more diffe
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Sperm protamine P1 (PRM1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Human Protamine 1 ELISA kit

    E01P0718-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Protamine 1 ELISA kit

    E01P0718-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Protamine 1 ELISA kit

    E01P0718-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Protamine 1 ELISA Kit

    abx051858-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human PRM1 ELISA Kit

    ELA-E1407h 96 Tests
    EUR 824

    PRM1 ELISA KIT|Human

    EF005719 96 Tests
    EUR 689

    Human Protamine ELISA Kit

    CN-04258H1 96T
    EUR 438

    Human Protamine ELISA Kit

    CN-04258H2 48T
    EUR 289

    Rat Protamine 1 ELISA kit

    E02P0718-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Protamine 1 ELISA kit

    E02P0718-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Protamine 1 ELISA kit

    E02P0718-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Protamine 1 ELISA kit

    E03P0718-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Protamine 1 ELISA kit

    E03P0718-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Protamine 1 ELISA kit

    E03P0718-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Protamine 1 ELISA kit

    E04P0718-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Protamine 1 ELISA kit

    E04P0718-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Protamine 1 ELISA kit

    E04P0718-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Protamine 1 ELISA kit

    E06P0718-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Protamine 1 ELISA kit

    E06P0718-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Protamine 1 ELISA kit

    E06P0718-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Protamine 1 ELISA kit

    E07P0718-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Protamine 1 ELISA kit

    E07P0718-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Protamine 1 ELISA kit

    E07P0718-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Protamine 1 ELISA kit

    E08P0718-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Protamine 1 ELISA kit

    E08P0718-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Protamine 1 ELISA kit

    E08P0718-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Protamine 1 ELISA kit

    E09P0718-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Protamine 1 ELISA kit

    E09P0718-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Protamine 1 ELISA kit

    E09P0718-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    PRM1 ELISA Kit (Human) (OKCD09042)

    OKCD09042 96 Wells
    EUR 975
    Description: Description of target: Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. They compact sperm DNA into a highly condensed, stable and inactive complex. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

    PRM1 ELISA Kit (Human) (OKEH04849)

    OKEH04849 96 Wells
    EUR 740
    Description: Description of target: Protamines substitute for histones in the chromatin of sperm during the haploid phase of spermatogenesis. They compact sperm DNA into a highly condensed, stable and inactive complex.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098IU/mL

    Guinea pig Protamine 1 ELISA kit

    E05P0718-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Protamine 1 ELISA kit

    E05P0718-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Protamine 1 ELISA kit

    E05P0718-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    anti-protamine 1

    YF-PA14046 50 ug
    EUR 363
    Description: Mouse polyclonal to protamine 1

    Human Protamine 2(PRM2) ELISA kit

    E01P0867-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Protamine 2(PRM2) ELISA kit

    E01P0867-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Protamine 2(PRM2) ELISA kit

    E01P0867-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Protamine- 2, PRM2 ELISA KIT

    ELI-35855h 96 Tests
    EUR 824

    Human Protamine- 3, PRM3 ELISA KIT

    ELI-45487h 96 Tests
    EUR 824

    Human Protamine 2 (PRM2) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Protamine 2 (PRM2) ELISA Kit

    DLR-PRM2-Hu-48T 48T
    EUR 517
    • Should the Human Protamine 2 (PRM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Protamine 2 (PRM2) in samples from tissue homogenates or other biological fluids.

    Human Protamine 2 (PRM2) ELISA Kit

    DLR-PRM2-Hu-96T 96T
    EUR 673
    • Should the Human Protamine 2 (PRM2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Protamine 2 (PRM2) in samples from tissue homogenates or other biological fluids.

    Human Protamine 2 (PRM2) ELISA Kit

    RD-PRM2-Hu-48Tests 48 Tests
    EUR 521

    Human Protamine 2 (PRM2) ELISA Kit

    RD-PRM2-Hu-96Tests 96 Tests
    EUR 723

    Human Protamine 2 (PRM2) ELISA Kit

    RDR-PRM2-Hu-48Tests 48 Tests
    EUR 544

    Human Protamine 2 (PRM2) ELISA Kit

    RDR-PRM2-Hu-96Tests 96 Tests
    EUR 756

    Human Protamine 3(PRM3)ELISA Kit

    QY-E00392 96T
    EUR 361

    Human Protamine 2(PRM2)ELISA Kit

    QY-E00393 96T
    EUR 361

    Human Protamine 2 (PRM2) ELISA Kit

    SEH307Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

    Human Protamine 2 (PRM2) ELISA Kit

    SEH307Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

    Human Protamine 2 (PRM2) ELISA Kit

    SEH307Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

    Human Protamine 2 (PRM2) ELISA Kit

    SEH307Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Protamine 2 (PRM2) in Tissue homogenates and other biological fluids.

    Human Protamine 2 (PRM2) ELISA Kit

    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Protamine 2 elisa. Alternative names of the recognized antigen: CT94.2
    • Cancer/Testis Antigen Family 94, Member 2
    • Sperm histone P2
    • Sperm protamine P2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Protamine 2 (PRM2) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    PRM1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PRM1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PRM1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Anti-protamine 1 (4F10)

    YF-MA14959 100 ug
    EUR 363
    Description: Mouse monoclonal to protamine 1

    ELISA kit for Human PRM2 (Protamine 2)

    ELK4739 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protamine 2 (PRM2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protamine 2 (PR
    • Show more
    Description: A sandwich ELISA kit for detection of Protamine 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human Protamine-3 (PRM3)

    KTE61139-48T 48T
    EUR 332
    • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Protamine-3 (PRM3)

    KTE61139-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Protamine-3 (PRM3)

    KTE61139-96T 96T
    EUR 539
    • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Protamine-2 (PRM2)

    KTE61140-48T 48T
    EUR 332
    • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Protamine-2 (PRM2)

    KTE61140-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Human Protamine-2 (PRM2)

    KTE61140-96T 96T
    EUR 539
    • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Human Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

    EXOAB-KIT-1 25 ul each
    EUR 627
    • Category: Exosomes

    mRNAExpress mRNA Synthesis kit (5 reactions)

    MR-KIT-1 5 reactions
    EUR 1152
    • Category: Stem Cell Products

    PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN320A-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

    PIN340iPS-KIT 1 Kit
    EUR 4941
    • Category: PinPoint Integrase Tools

    Human PRM1 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    PRM1 Recombinant Protein (Human)

    RP024661 100 ug Ask for price

    Rat Protamine 2(PRM2) ELISA kit

    E02P0867-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Protamine 2(PRM2) ELISA kit

    E02P0867-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat Protamine 2(PRM2) ELISA kit

    E02P0867-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Protamine 2(PRM2) ELISA kit

    E03P0867-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Protamine 2(PRM2) ELISA kit

    E03P0867-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse Protamine 2(PRM2) ELISA kit

    E03P0867-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Protamine 2(PRM2) ELISA kit

    E04P0867-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Protamine 2(PRM2) ELISA kit

    E04P0867-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Protamine 2(PRM2) ELISA kit

    E04P0867-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Protamine 2(PRM2) ELISA kit

    E06P0867-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Protamine 2(PRM2) ELISA kit

    E06P0867-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat Protamine 2(PRM2) ELISA kit

    E06P0867-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Protamine 2(PRM2) ELISA kit

    E07P0867-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Protamine 2(PRM2) ELISA kit

    E07P0867-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Pig Protamine 2(PRM2) ELISA kit

    E07P0867-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Porcine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Protamine 2(PRM2) ELISA kit

    E08P0867-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Protamine 2(PRM2) ELISA kit

    E08P0867-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Dog Protamine 2(PRM2) ELISA kit

    E08P0867-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Canine Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Protamine 2(PRM2) ELISA kit

    E09P0867-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Protamine 2(PRM2) ELISA kit

    E09P0867-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Monkey Protamine 2(PRM2) ELISA kit

    E09P0867-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Monkey Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Bovine Protamine- 2, PRM2 ELISA KIT

    ELI-15408b 96 Tests
    EUR 928

    Bovine Protamine- 3, PRM3 ELISA KIT

    ELI-15409b 96 Tests
    EUR 928

    Porcine Protamine- 2, PRM2 ELISA KIT

    ELI-15626p 96 Tests
    EUR 928

    Mouse Protamine- 2, Prm2 ELISA KIT

    ELI-16781m 96 Tests
    EUR 865

    Mouse Protamine- 3, Prm3 ELISA KIT

    ELI-45409m 96 Tests
    EUR 865

    Mouse Protamine 2 (PRM2) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Rat Protamine-2 (PRM2) ELISA Kit

    abx391855-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Protamine 2 (PRM2) ELISA Kit

    SEH307Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4862.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

    Mouse Protamine 2 (PRM2) ELISA Kit

    SEH307Mu-1x48wellstestplate 1x48-wells test plate
    EUR 488.08
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

    Mouse Protamine 2 (PRM2) ELISA Kit

    SEH307Mu-1x96wellstestplate 1x96-wells test plate
    EUR 654.4
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

    Mouse Protamine 2 (PRM2) ELISA Kit

    SEH307Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2644.8
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Protamine 2 (PRM2) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Protamine 2 (PRM2) in Tissue homogenates, cell lysates and other biological fluids.

    Mouse Protamine 2 (PRM2) ELISA Kit

    • EUR 4913.00
    • EUR 2595.00
    • EUR 655.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Protamine 2 elisa. Alternative names of the recognized antigen: CT94.2
    • Cancer/Testis Antigen Family 94, Member 2
    • Sperm histone P2
    • Sperm protamine P2
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Protamine 2 (PRM2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Prm2 ELISA Kit| Rat Protamine-2 ELISA Kit

    EF019215 96 Tests
    EUR 689

    Prm2 ELISA Kit| Mouse Protamine-2 ELISA Kit

    EF015958 96 Tests
    EUR 689

    PRM2 ELISA Kit| Bovine Protamine-2 ELISA Kit

    EF011800 96 Tests
    EUR 689

    PRM1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1724302 1.0 ug DNA
    EUR 154

    Human Protamine 2 (PRM2) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    PRM1 cloning plasmid

    CSB-CL018728HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 156
    • Sequence: atggccaggtacagatgctgtcgcagccagagccggagcagatattaccgccagagacaaagaagtcgcagacgaaggaggcggagctgccagacacggaggagagccatgaggtgctgccgccccaggtacagaccgagatgtagaagacactaa
    Description: A cloning plasmid for the PRM1 gene.

    PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN300A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

    CAS510A-KIT 1 Kit
    EUR 805
    • Category: Cas9

    PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

    PIN400A-KIT 1 Kit
    EUR 2798
    • Category: PinPoint Integrase Tools

    Guinea pig Protamine 2(PRM2) ELISA kit

    E05P0867-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Protamine 2(PRM2) ELISA kit

    E05P0867-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Guinea pig Protamine 2(PRM2) ELISA kit

    E05P0867-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Guinea pig Protamine 2(PRM2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    ELISA kit for Mouse PRM2 (Protamine 2)

    ELK7351 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Protamine 2 (PRM2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Protamine 2 (PR
    • Show more
    Description: A sandwich ELISA kit for detection of Protamine 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Pig Protamine-2 (PRM2)

    KTE80180-48T 48T
    EUR 354
    • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Pig Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Pig Protamine-2 (PRM2)

    KTE80180-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Pig Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Pig Protamine-2 (PRM2)

    KTE80180-96T 96T
    EUR 572
    • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Pig Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Protamine-3 (PRM3)

    KTE100421-48T 48T
    EUR 332
    • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Protamine-3 (PRM3)

    KTE100421-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Protamine-3 (PRM3)

    KTE100421-96T 96T
    EUR 539
    • Prm3 encoding a distinctive small acidic protein is present in 13 species from seven orders of mammals. Prm3 gene has not generated retroposons, which supports the contention that genes that are expressed in meiotic and haploid spermatogenic cells do
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protamine-3 (PRM3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Protamine-2 (PRM2)

    KTE100867-48T 48T
    EUR 332
    • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Protamine-2 (PRM2)

    KTE100867-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Rat Protamine-2 (PRM2)

    KTE100867-96T 96T
    EUR 539
    • Presumably PRM2 is located on human chromosome 16, close to PRM1: in the mouse the corresponding 2 loci are closely linked, and in the Chinese hamster, probes specific for the 2 protamines hybridize to the same restriction fragments after digestion o
    • Show more
    Description: Quantitative sandwich ELISA for measuring Rat Protamine-2 (PRM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.