Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit

Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit

To Order Contact us: 

    Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    SEJ123Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

    Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    SEJ123Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

    Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    SEJ123Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

    Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    SEJ123Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

    Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    4-SEJ123Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Fumarylacetoacetate Hydrolase elisa. Alternative names of the recognized antigen: FAA
    • Fumarylacetoacetase
    • Tyrosinemia 1
    • Beta-diketonase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fumarylacetoacetate Hydrolase (FAH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx112607
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx002320
    • EUR 495.00
    • EUR 356.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx102858
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx102859
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx036126-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx005052
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx026534-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx026534-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx018095-100ug 100 ug
    EUR 384
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx018096-100ug 100 ug
    EUR 384
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx317985
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx232948-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Recombinant Fumarylacetoacetate Hydrolase (FAH)

    4-RPJ123Hu01
    • EUR 517.54
    • EUR 241.00
    • EUR 1665.76
    • EUR 621.92
    • EUR 1143.84
    • EUR 409.00
    • EUR 4014.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P16930
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 18.9kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli

    Recombinant Fumarylacetoacetate Hydrolase (FAH)

    4-RPJ123Hu02
    • EUR 517.54
    • EUR 241.00
    • EUR 1665.76
    • EUR 621.92
    • EUR 1143.84
    • EUR 409.00
    • EUR 4014.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P16930
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 27.0kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli

    Human Fumarylacetoacetate Hydrolase (FAH) Protein

    20-abx066699
    • EUR 718.00
    • EUR 286.00
    • EUR 2249.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Human Fumarylacetoacetate Hydrolase (FAH) Protein

    20-abx066700
    • EUR 718.00
    • EUR 286.00
    • EUR 2249.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Mouse Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    20-abx389353
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.

    Human Fumarylacetoacetate Hydrolase (FAH) CLIA Kit

    20-abx495621
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human FAH (Fumarylacetoacetate Hydrolase)

    ELK4894 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fumarylacetoacetate Hydrolase (FAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
    • Show more
    Description: A sandwich ELISA kit for detection of Fumarylacetoacetate Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin)

    20-abx272420
    • EUR 453.00
    • EUR 244.00
    • EUR 1316.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody (HRP)

    20-abx303802
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody (FITC)

    20-abx303803
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin)

    20-abx303804
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human)

    4-PAJ123Hu02
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH)

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC

    4-PAJ123Hu02-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Biotinylated

    4-PAJ123Hu02-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Cy3

    4-PAJ123Hu02-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), FITC

    4-PAJ123Hu02-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), HRP

    4-PAJ123Hu02-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), PE

    4-PAJ123Hu02-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat)

    4-PAJ123Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH)

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC-Cy7

    4-PAJ123Hu02-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC

    4-PAJ123Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

    4-PAJ123Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Cy3

    4-PAJ123Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), FITC

    4-PAJ123Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), HRP

    4-PAJ123Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), PE

    4-PAJ123Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

    4-PAJ123Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7.

    Anti-Fumarylacetoacetate hydrolase (3G2)

    YF-MA12951 100 ug
    EUR 363
    Description: Mouse monoclonal to Fumarylacetoacetate hydrolase

    Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1

    7-02743 5µg Ask for price

    Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1

    7-02744 20µg Ask for price

    Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1

    7-02745 1mg Ask for price

    Fumarylacetoacetate Hydrolase Domain Containing 1 (Recombinant)

    20-abx073193
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    Fah/ Rat Fah ELISA Kit

    ELI-47608r 96 Tests
    EUR 886

    FAH ELISA KIT|Human

    EF009501 96 Tests
    EUR 689

    FAHD1 Fumarylacetoacetate Hydrolase Domain Containing 1 Human Recombinant Protein

    PROTQ6P587 Regular: 20ug
    EUR 317
    Description: FAHD1 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 244 amino acids (1-224 a.a.) and having a molecular mass of 27kDa. The FAHD1 is purified by proprietary chromatographic techniques.

    Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody

    abx030304-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody

    abx030304-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase Domain-Containing Protein 2A (FAHD2A) Antibody

    20-abx308897
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Human Fumarylacetoacetase, FAH ELISA KIT

    ELI-09815h 96 Tests
    EUR 824

    FAH ELISA Kit (Human) (OKCD00555)

    OKCD00555 96 Wells
    EUR 831
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL

    Mouse Fah/ Fumarylacetoacetase ELISA Kit

    E0499Mo 1 Kit
    EUR 632

    Mouse Fumarylacetoacetase, Fah ELISA KIT

    ELI-32960m 96 Tests
    EUR 865

    Bovine Fumarylacetoacetase, FAH ELISA KIT

    ELI-38504b 96 Tests
    EUR 928

    FAH ELISA Kit (Mouse) (OKEH08226)

    OKEH08226 96 Wells
    EUR 896
    Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.048ng/mL

    Fah ELISA Kit| Mouse Fumarylacetoacetase ELISA Kit

    EF014986 96 Tests
    EUR 689

    FAH ELISA Kit| Bovine Fumarylacetoacetase ELISA Kit

    EF011403 96 Tests
    EUR 689

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    FAH siRNA

    20-abx901829
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    FAH siRNA

    20-abx915946
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    FAH siRNA

    20-abx915947
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    FAH antibody

    70R-2625 50 ug
    EUR 467
    Description: Rabbit polyclonal FAH antibody

    FAH antibody

    39026-100ul 100ul
    EUR 252

    FAH Antibody

    39846-100ul 100ul
    EUR 390

    FAH antibody

    70R-17200 50 ul
    EUR 435
    Description: Rabbit polyclonal FAH antibody

    FAH antibody

    70R-1062 100 ug
    EUR 377
    Description: Rabbit polyclonal FAH antibody

    FAH Antibody

    1-CSB-PA007965GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    FAH Antibody

    1-CSB-PA007965LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

    Human FAH shRNA Plasmid

    20-abx951521
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    FAH Recombinant Protein (Human)

    RP011182 100 ug Ask for price

    FAH Conjugated Antibody

    C39026 100ul
    EUR 397

    FAH cloning plasmid

    CSB-CL007965HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1260
    • Sequence: atgtccttcatcccggtggccgaggattccgacttccccatccacaacctgccctacggcgtcttctcgaccagaggcgacccaagaccgaggataggtgtggccattggcgaccagatcctggacctcagcatcatcaagcacctctttactggtcctgtcctctccaaacacc
    • Show more
    Description: A cloning plasmid for the FAH gene.

    anti- FAH antibody

    FNab02948 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • Immunogen: fumarylacetoacetate hydrolase (fumarylacetoacetase)
    • Uniprot ID: P16930
    • Gene ID: 2184
    • Research Area: Metabolism
    Description: Antibody raised against FAH

    FAH Polyclonal Antibody

    A62538 100 µg
    EUR 570.55
    Description: reagents widely cited

    FAH Rabbit pAb

    A3238-100ul 100 ul
    EUR 384

    FAH Rabbit pAb

    A3238-200ul 200 ul Ask for price

    FAH Rabbit pAb

    A3238-20ul 20 ul Ask for price

    FAH Rabbit pAb

    A3238-50ul 50 ul
    EUR 265

    FAH Rabbit pAb

    A13492-100ul 100 ul
    EUR 308

    FAH Rabbit pAb

    A13492-200ul 200 ul
    EUR 459

    FAH Rabbit pAb

    A13492-20ul 20 ul
    EUR 183

    FAH Rabbit pAb

    A13492-50ul 50 ul
    EUR 223

    FAH Rabbit pAb

    A6586-100ul 100 ul
    EUR 308

    FAH Rabbit pAb

    A6586-200ul 200 ul
    EUR 459

    FAH Rabbit pAb

    A6586-20ul 20 ul
    EUR 183

    FAH Rabbit pAb

    A6586-50ul 50 ul
    EUR 223

    FAH Blocking Peptide

    33R-1054 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EPN1 antibody, catalog no. 70R-3618

    FAH Blocking Peptide

    33R-8429 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAH antibody, catalog no. 70R-2625

    Anti-FAH antibody

    PAab02948 100 ug
    EUR 355

    Anti-FAH antibody

    STJ28669 100 µl
    EUR 277
    Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).

    Anti-FAH antibody

    STJ23615 100 µl
    EUR 393
    Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).

    Anti-FAH antibody

    STJ115453 100 µl
    EUR 277
    Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).

    FAH ORF Vector (Human) (pORF)

    ORF003728 1.0 ug DNA
    EUR 95

    Human Bleomycin hydrolase(BLMH) ELISA kit

    E01B0805-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Bleomycin hydrolase(BLMH) ELISA kit

    E01B0805-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Bleomycin hydrolase(BLMH) ELISA kit

    E01B0805-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Bleomycin hydrolase(BLMH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Acyloxyacyl hydrolase(AOAH) ELISA kit

    E01A1552-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Acyloxyacyl hydrolase(AOAH) ELISA kit

    E01A1552-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Acyloxyacyl hydrolase(AOAH) ELISA kit

    E01A1552-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Acyloxyacyl hydrolase(AOAH) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human γ Glutamate Hydrolase ELISA kit

    E01G0559-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human γ Glutamate Hydrolase ELISA kit

    E01G0559-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human γ Glutamate Hydrolase ELISA kit

    E01G0559-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human γ Glutamate Hydrolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit

    E01H0015-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit

    E01H0015-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Hydroxyacylglutathione hydrolase, Mitochondrial ELISA kit

    E01H0015-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Hydroxyacylglutathione hydrolase, Mitochondrial in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human HAGH(Hydroxyacylglutathione Hydrolase) ELISA Kit

    EH3210 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: Q16775
    • Alias: HAGH/GLX2/HAGH/GLO2hydroxyacyl glutathione hydrolase/Glx II/GLXII/Glyoxalase II/HAGH1GLX2/hydroxyacylglutathione hydrolase/hydroxyacylglutathione hydrolase, mitochondrial/hydroxyacylglutathion
    • Show more
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human Valacyclovir hydrolase, BPHL ELISA KIT

    ELI-11153h 96 Tests
    EUR 824

    Human Acyloxyacyl hydrolase, AOAH ELISA KIT

    ELI-34429h 96 Tests
    EUR 824

    Human Bleomycin hydrolase, BLMH ELISA KIT

    ELI-50039h 96 Tests
    EUR 824

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    20-abx150541
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    20-abx150813
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Valacyclovir Hydrolase (BPHL) ELISA Kit

    20-abx386067
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.

    Human Hydroxyacylglutathione Hydrolase (HAGH) ELISA Kit

    abx252611-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Human Acyloxyacyl Hydrolase (AOAH)ELISA Kit

    201-12-2818 96 tests
    EUR 440
    • This Acyloxyacyl Hydrolase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    DLR-AOAH-Hu-48T 48T
    EUR 517
    • Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    DLR-AOAH-Hu-96T 96T
    EUR 673
    • Should the Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    DLR-BLMH-Hu-48T 48T
    EUR 517
    • Should the Human Bleomycin Hydrolase (BLMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    DLR-BLMH-Hu-96T 96T
    EUR 673
    • Should the Human Bleomycin Hydrolase (BLMH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Acyloxyacyl hydrolase(AOAH) ELISA kit

    CSB-EL001853HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Acyloxyacyl hydrolase(AOAH) ELISA kit

    1-CSB-EL001853HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Acyloxyacyl hydrolase(AOAH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Bleomycin hydrolase(BLMH) ELISA kit

    CSB-EL002716HU-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase (BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Bleomycin hydrolase(BLMH) ELISA kit

    1-CSB-EL002716HU
    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Bleomycin hydrolase(BLMH) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    SEC220Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    SEC220Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    SEC220Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    SEC220Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Bleomycin Hydrolase (BLMH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Bleomycin Hydrolase (BLMH) in tissue homogenates, cell lysates and other biological fluids.

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    4-SEC220Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Bleomycin Hydrolase elisa. Alternative names of the recognized antigen: BH
    • BMH
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Bleomycin Hydrolase (BLMH) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Bleomycin Hydrolase ELISA Kit (BLMH)

    RK00979 96 Tests
    EUR 521

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    RD-AOAH-Hu-48Tests 48 Tests
    EUR 521

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    RD-AOAH-Hu-96Tests 96 Tests
    EUR 723

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    RD-BLMH-Hu-48Tests 48 Tests
    EUR 521

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    RD-BLMH-Hu-96Tests 96 Tests
    EUR 723

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    RDR-AOAH-Hu-48Tests 48 Tests
    EUR 544

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    RDR-AOAH-Hu-96Tests 96 Tests
    EUR 756

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    RDR-BLMH-Hu-48Tests 48 Tests
    EUR 544

    Human Bleomycin Hydrolase (BLMH) ELISA Kit

    RDR-BLMH-Hu-96Tests 96 Tests
    EUR 756

    Human Hydroxyacylglutathione Hydrolase(HAGH)ELISA Kit

    QY-E01881 96T
    EUR 361

    Human Acyloxyacyl Hydrolase(AOAH)ELISA Kit

    QY-E00892 96T
    EUR 361

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    SEJ634Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    SEJ634Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    SEJ634Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    SEJ634Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Acyloxyacyl Hydrolase (AOAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Acyloxyacyl Hydrolase (AOAH) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

    Human Acyloxyacyl Hydrolase (AOAH) ELISA Kit

    4-SEJ634Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Acyloxyacyl Hydrolase elisa. Alternative names of the recognized antigen: n/a
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Acyloxyacyl Hydrolase (AOAH) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Rat FAH shRNA Plasmid

    20-abx985461
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse FAH shRNA Plasmid

    20-abx970277
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    FAH Antibody, HRP conjugated

    1-CSB-PA007965LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against FAH. Recognizes FAH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    FAH Antibody, FITC conjugated

    1-CSB-PA007965LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against FAH. Recognizes FAH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    FAH Antibody, Biotin conjugated

    1-CSB-PA007965LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against FAH. Recognizes FAH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    FAH Recombinant Protein (Rat)

    RP200270 100 ug Ask for price

    FAH Recombinant Protein (Mouse)

    RP132728 100 ug Ask for price

    Recombinant Human Fumarylacetoacetase/FAH (C-6His)

    C874-10ug 10ug
    EUR 202
    Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

    Recombinant Human Fumarylacetoacetase/FAH (C-6His)

    C874-1mg 1mg
    EUR 2283
    Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

    Recombinant Human Fumarylacetoacetase/FAH (C-6His)

    C874-500ug 500ug
    EUR 1613
    Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

    Recombinant Human Fumarylacetoacetase/FAH (C-6His)

    C874-50ug 50ug
    EUR 496
    Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

    FAH sgRNA CRISPR Lentivector set (Human)

    K0711501 3 x 1.0 ug
    EUR 339

    Human S-formylglutathione hydrolase (ESD) ELISA Kit

    abx555912-96tests 96 tests
    EUR 668
    • Shipped within 1-3 weeks.

    Human Leukotriene A4 Hydrolase (LTA4H) ELISA Kit

    abx572445-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Human Epoxide hydrolase 1(EPHX1) ELISA kit

    E01E0380-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Epoxide hydrolase 1(EPHX1) ELISA kit

    E01E0380-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Epoxide hydrolase 1(EPHX1) ELISA kit

    E01E0380-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 1(EPHX1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Epoxide hydrolase 2(EPHX2) ELISA kit

    E01E0381-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Epoxide hydrolase 2(EPHX2) ELISA kit

    E01E0381-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Epoxide hydrolase 2(EPHX2) ELISA kit

    E01E0381-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Epoxide hydrolase 2(EPHX2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit

    E01L0040-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit

    E01L0040-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human Leukotriene A4 Hydrolase (LTA4H) ELISA kit

    E01L0040-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human Leukotriene A4 Hydrolase (LTA4H) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human EPHX4/ Epoxide hydrolase 4 ELISA Kit

    E0804Hu 1 Kit
    EUR 571

    Human ESD/ S-formylglutathione hydrolase ELISA Kit

    E0819Hu 1 Kit
    EUR 605

    Human GGH(Gamma-glutamyl hydrolase) ELISA Kit

    EH4206 96T
    EUR 524.1
    • Detection range: 0.469-30 ng/ml
    • Uniprot ID: Q92820
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.281 ng/ml

    Human EPHX4(Epoxide hydrolase 4) ELISA Kit

    EH2072 96T
    EUR 567.6
    • Detection range: 0.312-20 ng/ml
    • Uniprot ID: Q8IUS5
    • Alias: EPHX4(Epoxide hydrolase 4)/ABHD7/EPHXRP/Abhydrolase domain-containing protein 7/Epoxide hydrolase-related protein
    Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human LTA4H(Leukotriene A4 Hydrolase) ELISA Kit

    EH3307 96T
    EUR 524.1
    • Detection range: 0.313-20 ng/ml
    • Uniprot ID: P09960
    • Alias: LTA4H/EC 3.3.2.6/Leukotriene A(4) hydrolase/leukotriene A4 hydrolase/leukotriene A-4 hydrolase/LTA4/LTA-4 hydrolase
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

    Human Putative hydrolase RBBP9, RBBP9 ELISA KIT

    ELI-14004h 96 Tests
    EUR 824

    Human Lactase- phlorizin hydrolase, LCT ELISA KIT

    ELI-23573h 96 Tests
    EUR 824

    Human Epoxide hydrolase 4, EPHX4 ELISA KIT

    ELI-06582h 96 Tests
    EUR 824

    Human Mitochondrial cardiolipin hydrolase, PLD6 ELISA KIT

    ELI-15234h 96 Tests
    EUR 824

    Human Epoxide hydrolase 3, EPHX3 ELISA KIT

    ELI-09713h 96 Tests
    EUR 824

    ELISA kit for Human BLMH (Bleomycin Hydrolase)

    ELK3153 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Bleomycin Hydrolase (BLMH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Bleomyc
    • Show more
    Description: A sandwich ELISA kit for detection of Bleomycin Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    ELISA kit for Human AOAH (Acyloxyacyl Hydrolase)

    ELK3978 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Acyloxyacyl Hydrolase (AOAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Acylo
    • Show more
    Description: A sandwich ELISA kit for detection of Acyloxyacyl Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Ester hydrolase C11orf54, C11orf54 ELISA KIT

    ELI-33206h 96 Tests
    EUR 824

    Human Probable hydrolase PNKD, PNKD ELISA KIT

    ELI-36132h 96 Tests
    EUR 824

    Human Epoxide hydrolase 1, EPHX1 ELISA KIT

    ELI-43306h 96 Tests
    EUR 824