Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit

Human FAH(Fumarylacetoacetate Hydrolase) ELISA Kit

To Order Contact us: 

    Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    SEJ123Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

    Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    SEJ123Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

    Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    SEJ123Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

    Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    SEJ123Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fumarylacetoacetate Hydrolase (FAH) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay:
    • Show more
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fumarylacetoacetate Hydrolase (FAH) in serum, plasma, tissue homogenates and other biological fluids.

    Human Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    4-SEJ123Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Fumarylacetoacetate Hydrolase elisa. Alternative names of the recognized antigen: FAA
    • Fumarylacetoacetase
    • Tyrosinemia 1
    • Beta-diketonase
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fumarylacetoacetate Hydrolase (FAH) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx026534-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx026534-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx005052
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx018095-100ug 100 ug
    EUR 384
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx018096-100ug 100 ug
    EUR 384
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx102858
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx102859
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx112607
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx036126-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx317985
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    abx232948-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody

    20-abx002320
    • EUR 495.00
    • EUR 356.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Recombinant Fumarylacetoacetate Hydrolase (FAH)

    4-RPJ123Hu01
    • EUR 517.54
    • EUR 241.00
    • EUR 1665.76
    • EUR 621.92
    • EUR 1143.84
    • EUR 409.00
    • EUR 4014.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P16930
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 18.9kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli

    Recombinant Fumarylacetoacetate Hydrolase (FAH)

    4-RPJ123Hu02
    • EUR 517.54
    • EUR 241.00
    • EUR 1665.76
    • EUR 621.92
    • EUR 1143.84
    • EUR 409.00
    • EUR 4014.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P16930
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 27.0kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Fumarylacetoacetate Hydrolase expressed in: E.coli

    Mouse Fumarylacetoacetate Hydrolase (FAH) ELISA Kit

    20-abx389353
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-12 working days.

    Human Fumarylacetoacetate Hydrolase (FAH) Protein

    20-abx066699
    • EUR 718.00
    • EUR 286.00
    • EUR 2249.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Human Fumarylacetoacetate Hydrolase (FAH) Protein

    20-abx066700
    • EUR 718.00
    • EUR 286.00
    • EUR 2249.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Human Fumarylacetoacetate Hydrolase (FAH) CLIA Kit

    20-abx495621
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    ELISA kit for Human FAH (Fumarylacetoacetate Hydrolase)

    ELK4894 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fumarylacetoacetate Hydrolase (FAH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific t
    • Show more
    Description: A sandwich ELISA kit for detection of Fumarylacetoacetate Hydrolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin)

    20-abx272420
    • EUR 453.00
    • EUR 244.00
    • EUR 1316.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody (HRP)

    20-abx303802
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody (FITC)

    20-abx303803
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Antibody (Biotin)

    20-abx303804
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human)

    4-PAJ123Hu02
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH)

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC

    4-PAJ123Hu02-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Biotinylated

    4-PAJ123Hu02-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), Cy3

    4-PAJ123Hu02-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), FITC

    4-PAJ123Hu02-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), HRP

    4-PAJ123Hu02-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), PE

    4-PAJ123Hu02-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat)

    4-PAJ123Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH)

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human), APC-Cy7

    4-PAJ123Hu02-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Val189~Ser419)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC

    4-PAJ123Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

    4-PAJ123Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Biotin.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), Cy3

    4-PAJ123Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with Cy3.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), FITC

    4-PAJ123Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with FITC.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), HRP

    4-PAJ123Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with HRP.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), PE

    4-PAJ123Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with PE.

    Fumarylacetoacetate Hydrolase (FAH) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

    4-PAJ123Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: FAH (Ile40~Leu195)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Fumarylacetoacetate Hydrolase (FAH). This antibody is labeled with APC-Cy7.

    Anti-Fumarylacetoacetate hydrolase (3G2)

    YF-MA12951 100 ug
    EUR 363
    Description: Mouse monoclonal to Fumarylacetoacetate hydrolase

    Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1

    7-02743 5µg Ask for price

    Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1

    7-02744 20µg Ask for price

    Recombinant Human Fumarylacetoacetate Hydrolase Domain Containing 1

    7-02745 1mg Ask for price

    Fumarylacetoacetate Hydrolase Domain Containing 1 (Recombinant)

    20-abx073193
    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    Fah/ Rat Fah ELISA Kit

    ELI-47608r 96 Tests
    EUR 886

    FAH ELISA KIT|Human

    EF009501 96 Tests
    EUR 689

    FAHD1 Fumarylacetoacetate Hydrolase Domain Containing 1 Human Recombinant Protein

    PROTQ6P587 Regular: 20ug
    EUR 317
    Description: FAHD1 Human Recombinant fused with a 20 amino acid His tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 244 amino acids (1-224 a.a.) and having a molecular mass of 27kDa. The FAHD1 is purified by proprietary chromatographic techniques.

    Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody

    abx030304-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase Domain-Containing Protein 2B (FAHD2B) Antibody

    abx030304-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Fumarylacetoacetate Hydrolase Domain-Containing Protein 2A (FAHD2A) Antibody

    20-abx308897
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Human Fumarylacetoacetase, FAH ELISA KIT

    ELI-09815h 96 Tests
    EUR 824

    FAH ELISA Kit (Human) (OKCD00555)

    OKCD00555 96 Wells
    EUR 831
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.058 ng/mL

    Mouse Fah/ Fumarylacetoacetase ELISA Kit

    E0499Mo 1 Kit
    EUR 632

    Mouse Fumarylacetoacetase, Fah ELISA KIT

    ELI-32960m 96 Tests
    EUR 865

    Bovine Fumarylacetoacetase, FAH ELISA KIT

    ELI-38504b 96 Tests
    EUR 928

    FAH ELISA Kit (Mouse) (OKEH08226)

    OKEH08226 96 Wells
    EUR 896
    Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.048ng/mL

    Fah ELISA Kit| Mouse Fumarylacetoacetase ELISA Kit

    EF014986 96 Tests
    EUR 689

    FAH ELISA Kit| Bovine Fumarylacetoacetase ELISA Kit

    EF011403 96 Tests
    EUR 689

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    FAH antibody

    70R-17200 50 ul
    EUR 435
    Description: Rabbit polyclonal FAH antibody

    FAH antibody

    70R-1062 100 ug
    EUR 377
    Description: Rabbit polyclonal FAH antibody

    FAH antibody

    70R-2625 50 ug
    EUR 467
    Description: Rabbit polyclonal FAH antibody

    FAH antibody

    39026-100ul 100ul
    EUR 252

    FAH Antibody

    39846-100ul 100ul
    EUR 390

    FAH Antibody

    1-CSB-PA007965GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    FAH Antibody

    1-CSB-PA007965LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against FAH. Recognizes FAH from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

    FAH siRNA

    20-abx901829
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    FAH siRNA

    20-abx915946
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    FAH siRNA

    20-abx915947
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Human FAH shRNA Plasmid

    20-abx951521
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    FAH Recombinant Protein (Human)

    RP011182 100 ug Ask for price

    FAH Rabbit pAb

    A13492-100ul 100 ul
    EUR 308

    FAH Rabbit pAb

    A13492-200ul 200 ul
    EUR 459

    FAH Rabbit pAb

    A13492-20ul 20 ul
    EUR 183

    FAH Rabbit pAb

    A13492-50ul 50 ul
    EUR 223

    FAH Blocking Peptide

    33R-1054 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EPN1 antibody, catalog no. 70R-3618

    FAH Blocking Peptide

    33R-8429 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FAH antibody, catalog no. 70R-2625

    FAH Conjugated Antibody

    C39026 100ul
    EUR 397

    FAH cloning plasmid

    CSB-CL007965HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1260
    • Sequence: atgtccttcatcccggtggccgaggattccgacttccccatccacaacctgccctacggcgtcttctcgaccagaggcgacccaagaccgaggataggtgtggccattggcgaccagatcctggacctcagcatcatcaagcacctctttactggtcctgtcctctccaaacacc
    • Show more
    Description: A cloning plasmid for the FAH gene.

    FAH Rabbit pAb

    A6586-100ul 100 ul
    EUR 308

    FAH Rabbit pAb

    A6586-200ul 200 ul
    EUR 459

    FAH Rabbit pAb

    A6586-20ul 20 ul
    EUR 183

    FAH Rabbit pAb

    A6586-50ul 50 ul
    EUR 223

    FAH Polyclonal Antibody

    A62538 100 µg
    EUR 570.55
    Description: reagents widely cited

    FAH Rabbit pAb

    A3238-100ul 100 ul
    EUR 384

    FAH Rabbit pAb

    A3238-200ul 200 ul Ask for price

    FAH Rabbit pAb

    A3238-20ul 20 ul Ask for price

    FAH Rabbit pAb

    A3238-50ul 50 ul
    EUR 265

    anti- FAH antibody

    FNab02948 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • Immunogen: fumarylacetoacetate hydrolase (fumarylacetoacetase)
    • Uniprot ID: P16930
    • Gene ID: 2184
    • Research Area: Metabolism
    Description: Antibody raised against FAH

    Anti-FAH antibody

    PAab02948 100 ug
    EUR 355

    Anti-FAH antibody

    STJ28669 100 µl
    EUR 277
    Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).

    Anti-FAH antibody

    STJ115453 100 µl
    EUR 277
    Description: This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT).