Human NPTN(Neuroplastin) ELISA Kit

Human NPTN(Neuroplastin) ELISA Kit

To Order Contact us: 

Human Neuroplastin (NPTN) ELISA Kit

RDR-NPTN-Hu-48Tests 48 Tests
EUR 544

Human Neuroplastin (NPTN) ELISA Kit

RDR-NPTN-Hu-96Tests 96 Tests
EUR 756

Human Neuroplastin (NPTN) ELISA Kit

RD-NPTN-Hu-48Tests 48 Tests
EUR 521

Human Neuroplastin (NPTN) ELISA Kit

RD-NPTN-Hu-96Tests 96 Tests
EUR 723

Human Neuroplastin (NPTN) ELISA Kit

20-abx152508
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Neuroplastin (NPTN) ELISA Kit

abx257574-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Human NPTN(Neuroplastin) ELISA Kit

EH4175 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: Q9Y639
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Neuroplastin, NPTN ELISA KIT

ELI-14849h 96 Tests
EUR 824

Human Neuroplastin(NPTN)ELISA Kit

QY-E04762 96T
EUR 361

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

SEC666Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

Human Neuroplastin (NPTN) ELISA Kit

4-SEC666Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuroplastin elisa. Alternative names of the recognized antigen: SDR1
  • GP55
  • GP65
  • SDFR1
  • np55
  • np65
  • Stromal Cell Derived Factor Receptor 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuroplastin (NPTN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Neuroplastin (NPTN) ELISA Kit

abx391703-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Neuroplastin (NPTN) ELISA Kit

abx390037-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Neuroplastin, Nptn ELISA KIT

ELI-35323r 96 Tests
EUR 886

Mouse Neuroplastin, Nptn ELISA KIT

ELI-39707m 96 Tests
EUR 865

Neuroplastin (NPTN) Antibody

20-abx006050
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

abx027055-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

abx027055-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

20-abx177788
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuroplastin (NPTN) Antibody

abx146042-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

20-abx173801
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuroplastin (NPTN) Antibody

20-abx321072
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

20-abx326686
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuroplastin (NPTN) Antibody

20-abx321948
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ELISA kit for Human NPTN (Neuroplastin)

ELK4704 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuroplastin (NPTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuroplastin (
  • Show more
Description: A sandwich ELISA kit for detection of Neuroplastin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Neuroplastin (NPTN) CLIA Kit

20-abx493824
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neuroplastin (NPTN) Protein

20-abx654543
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Nptn ELISA Kit| Rat Neuroplastin ELISA Kit

EF019063 96 Tests
EUR 689

Nptn ELISA Kit| Mouse Neuroplastin ELISA Kit

EF015676 96 Tests
EUR 689

NPTN ELISA KIT|Human

EF007364 96 Tests
EUR 689

Neuroplastin antibody

70R-1874 100 ug
EUR 377
Description: Rabbit polyclonal Neuroplastin antibody raised against the middle region of NPTN

Neuroplastin antibody

70R-7282 50 ug
EUR 467
Description: Rabbit polyclonal Neuroplastin antibody raised against the middle region of NPTN

Neuroplastin Blocking Peptide

33R-8310 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NPTN antibody, catalog no. 70R-7282

Neuroplastin Blocking Peptide

33R-5985 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NPTN antibody, catalog no. 70R-1874

Neuroplastin Polyclonal Antibody

ABP54531-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

Neuroplastin Polyclonal Antibody

ABP54531-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

Neuroplastin Polyclonal Antibody

ABP54531-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

Neuroplastin Polyclonal Antibody

ES5530-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Neuroplastin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Neuroplastin Polyclonal Antibody

ES5530-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Neuroplastin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Anti-Neuroplastin antibody

STJ94440 200 µl
EUR 197
Description: Rabbit polyclonal to Neuroplastin.

NPTN antibody

10R-7067 100 ul
EUR 726
Description: Mouse monoclonal NPTN antibody

NPTN antibody

10R-7068 100 ul
EUR 691
Description: Mouse monoclonal NPTN antibody

NPTN antibody

10R-7069 100 ul
EUR 691
Description: Mouse monoclonal NPTN antibody

NPTN Antibody

1-CSB-PA016028ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

NPTN Antibody

1-CSB-PA016028ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NPTN Antibody

1-CSB-PA008837
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

NPTN siRNA

20-abx903630
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPTN siRNA

20-abx926287
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPTN siRNA

20-abx926288
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human NPTN shRNA Plasmid

20-abx958925
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NPTN Recombinant Protein (Human)

RP041734 100 ug Ask for price

NPTN Polyclonal Antibody

31395-100ul 100ul
EUR 252

NPTN Polyclonal Antibody

31395-50ul 50ul
EUR 187

NPTN cloning plasmid

CSB-CL016028HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 849
  • Sequence: atgtcgggttcgtcgctgcccagcgccctggccctctcgctgttgctggtctctggctccctcctcccagggccaggcgccgctcagaacgagccaaggattgtcaccagtgaagaggtcattattcgagacagccctgttctccctgtcaccctgcagtgtaacctcacctccag
  • Show more
Description: A cloning plasmid for the NPTN gene.

NPTN Rabbit pAb

A7972-100ul 100 ul
EUR 308

NPTN Rabbit pAb

A7972-200ul 200 ul
EUR 459

NPTN Rabbit pAb

A7972-20ul 20 ul
EUR 183

NPTN Rabbit pAb

A7972-50ul 50 ul
EUR 223

Anti-NPTN antibody

STJ110279 100 µl
EUR 277
Description: This gene encodes a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. Alternative splicing results in multiple transcript variants.

NPTN ORF Vector (Human) (pORF)

ORF013912 1.0 ug DNA
EUR 354

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse NPTN shRNA Plasmid

20-abx972619
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NPTN shRNA Plasmid

20-abx985858
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NPTN Polyclonal Conjugated Antibody

C31395 100ul
EUR 397

NPTN Recombinant Protein (Mouse)

RP154784 100 ug Ask for price

NPTN Recombinant Protein (Rat)

RP214388 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

NPTN sgRNA CRISPR Lentivector set (Human)

K1449901 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Nptn ORF Vector (Rat) (pORF)

ORF071464 1.0 ug DNA
EUR 506

h NPTN inducible lentiviral particles

LVP406 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made inducible lentiviral particles for expressing human target: NPTN (alternative name: GP55; GP65; SDR1; np55; np65; SDFR1), with ORF sequence 100% matching to CDS region in NCBI ID: NM_017455.