Human NPTN(Neuroplastin) ELISA Kit

Human NPTN(Neuroplastin) ELISA Kit

To Order Contact us: 

    Human Neuroplastin (NPTN) ELISA Kit

    RDR-NPTN-Hu-48Tests 48 Tests
    EUR 544

    Human Neuroplastin (NPTN) ELISA Kit

    RDR-NPTN-Hu-96Tests 96 Tests
    EUR 756

    Human Neuroplastin (NPTN) ELISA Kit

    RD-NPTN-Hu-48Tests 48 Tests
    EUR 521

    Human Neuroplastin (NPTN) ELISA Kit

    RD-NPTN-Hu-96Tests 96 Tests
    EUR 723

    Human Neuroplastin (NPTN) ELISA Kit

    20-abx152508
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Neuroplastin (NPTN) ELISA Kit

    abx257574-96tests 96 tests
    EUR 637
    • Shipped within 5-12 working days.

    Human NPTN(Neuroplastin) ELISA Kit

    EH4175 96T
    EUR 524.1
    • Detection range: 31.25-2000 pg/ml
    • Uniprot ID: Q9Y639
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

    Human Neuroplastin, NPTN ELISA KIT

    ELI-14849h 96 Tests
    EUR 824

    Human Neuroplastin(NPTN)ELISA Kit

    QY-E04762 96T
    EUR 361

    Human Neuroplastin (NPTN) ELISA Kit

    SEC666Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

    Human Neuroplastin (NPTN) ELISA Kit

    SEC666Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

    Human Neuroplastin (NPTN) ELISA Kit

    SEC666Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

    Human Neuroplastin (NPTN) ELISA Kit

    SEC666Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

    Human Neuroplastin (NPTN) ELISA Kit

    4-SEC666Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Neuroplastin elisa. Alternative names of the recognized antigen: SDR1
    • GP55
    • GP65
    • SDFR1
    • np55
    • np65
    • Stromal Cell Derived Factor Receptor 1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuroplastin (NPTN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Neuroplastin (NPTN) Antibody

    20-abx006050
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    abx027055-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    abx027055-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    20-abx177788
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Neuroplastin (NPTN) Antibody

    abx146042-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    20-abx173801
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Neuroplastin (NPTN) Antibody

    20-abx321072
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    20-abx326686
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    20-abx321948
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Rat Neuroplastin (NPTN) ELISA Kit

    abx391703-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Neuroplastin (NPTN) ELISA Kit

    abx390037-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Rat Neuroplastin, Nptn ELISA KIT

    ELI-35323r 96 Tests
    EUR 886

    Mouse Neuroplastin, Nptn ELISA KIT

    ELI-39707m 96 Tests
    EUR 865

    ELISA kit for Human NPTN (Neuroplastin)

    ELK4704 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuroplastin (NPTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuroplastin (
    • Show more
    Description: A sandwich ELISA kit for detection of Neuroplastin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Neuroplastin (NPTN) Protein

    20-abx654543
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Human Neuroplastin (NPTN) CLIA Kit

    20-abx493824
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Nptn ELISA Kit| Rat Neuroplastin ELISA Kit

    EF019063 96 Tests
    EUR 689

    Nptn ELISA Kit| Mouse Neuroplastin ELISA Kit

    EF015676 96 Tests
    EUR 689

    NPTN ELISA KIT|Human

    EF007364 96 Tests
    EUR 689

    NPTN ELISA Kit (Human) (OKCD08220)

    OKCD08220 96 Wells
    EUR 975
    Description: Description of target: Neuroplastin is a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. The alpha and beta transcripts show differential localization within the brain.Neuroplastin is a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. The alpha and beta transcripts show differential localization within the brain.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

    NPTN ELISA Kit (Human) (OKDD00432)

    OKDD00432 96 Wells
    EUR 975
    Description: Description of target: This gene encodes a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.052 ng/mL

    Neuroplastin antibody

    70R-1874 100 ug
    EUR 377
    Description: Rabbit polyclonal Neuroplastin antibody raised against the middle region of NPTN

    Neuroplastin antibody

    70R-7282 50 ug
    EUR 467
    Description: Rabbit polyclonal Neuroplastin antibody raised against the middle region of NPTN

    Neuroplastin Blocking Peptide

    33R-8310 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NPTN antibody, catalog no. 70R-7282

    Neuroplastin Blocking Peptide

    33R-5985 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NPTN antibody, catalog no. 70R-1874

    Neuroplastin Polyclonal Antibody

    ABP54531-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
    • Applications tips:
    Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

    Neuroplastin Polyclonal Antibody

    ABP54531-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
    • Applications tips:
    Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

    Neuroplastin Polyclonal Antibody

    ABP54531-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
    • Applications tips:
    Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

    Neuroplastin Polyclonal Antibody

    ES5530-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Neuroplastin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

    Neuroplastin Polyclonal Antibody

    ES5530-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Neuroplastin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

    Anti-Neuroplastin antibody

    STJ94440 200 µl
    EUR 197
    Description: Rabbit polyclonal to Neuroplastin.

    NPTN antibody

    10R-7067 100 ul
    EUR 726
    Description: Mouse monoclonal NPTN antibody

    NPTN antibody

    10R-7068 100 ul
    EUR 691
    Description: Mouse monoclonal NPTN antibody

    NPTN antibody

    10R-7069 100 ul
    EUR 691
    Description: Mouse monoclonal NPTN antibody

    NPTN Antibody

    1-CSB-PA016028ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

    NPTN Antibody

    1-CSB-PA016028ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    NPTN Antibody

    1-CSB-PA008837
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

    NPTN siRNA

    20-abx903630
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NPTN siRNA

    20-abx926287
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NPTN siRNA

    20-abx926288
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Human NPTN shRNA Plasmid

    20-abx958925
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    NPTN Recombinant Protein (Human)

    RP041734 100 ug Ask for price

    NPTN Polyclonal Antibody

    31395-100ul 100ul
    EUR 252

    NPTN Polyclonal Antibody

    31395-50ul 50ul
    EUR 187

    NPTN cloning plasmid

    CSB-CL016028HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 849
    • Sequence: atgtcgggttcgtcgctgcccagcgccctggccctctcgctgttgctggtctctggctccctcctcccagggccaggcgccgctcagaacgagccaaggattgtcaccagtgaagaggtcattattcgagacagccctgttctccctgtcaccctgcagtgtaacctcacctccag
    • Show more
    Description: A cloning plasmid for the NPTN gene.

    NPTN Rabbit pAb

    A7972-100ul 100 ul
    EUR 308

    NPTN Rabbit pAb

    A7972-200ul 200 ul
    EUR 459

    NPTN Rabbit pAb

    A7972-20ul 20 ul
    EUR 183

    NPTN Rabbit pAb

    A7972-50ul 50 ul
    EUR 223

    Anti-NPTN antibody

    STJ110279 100 µl
    EUR 277
    Description: This gene encodes a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. Alternative splicing results in multiple transcript variants.

    NPTN ORF Vector (Human) (pORF)

    ORF013912 1.0 ug DNA
    EUR 354

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    Mouse NPTN shRNA Plasmid

    20-abx972619
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat NPTN shRNA Plasmid

    20-abx985858
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    NPTN Polyclonal Conjugated Antibody

    C31395 100ul
    EUR 397

    NPTN Recombinant Protein (Mouse)

    RP154784 100 ug Ask for price

    NPTN Recombinant Protein (Rat)

    RP214388 100 ug Ask for price

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    NPTN sgRNA CRISPR Lentivector set (Human)

    K1449901 3 x 1.0 ug
    EUR 339

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9