Human NPTN(Neuroplastin) ELISA Kit

Human NPTN(Neuroplastin) ELISA Kit

To Order Contact us: 

    Human Neuroplastin (NPTN) ELISA Kit

    RD-NPTN-Hu-48Tests 48 Tests
    EUR 521

    Human Neuroplastin (NPTN) ELISA Kit

    RD-NPTN-Hu-96Tests 96 Tests
    EUR 723

    Human Neuroplastin (NPTN) ELISA Kit

    RDR-NPTN-Hu-48Tests 48 Tests
    EUR 544

    Human Neuroplastin (NPTN) ELISA Kit

    RDR-NPTN-Hu-96Tests 96 Tests
    EUR 756

    Human NPTN(Neuroplastin) ELISA Kit

    EH4175 96T
    EUR 524.1
    • Detection range: 31.25-2000 pg/ml
    • Uniprot ID: Q9Y639
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

    Human Neuroplastin, NPTN ELISA KIT

    ELI-14849h 96 Tests
    EUR 824

    Human Neuroplastin (NPTN) ELISA Kit

    20-abx152508
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Neuroplastin (NPTN) ELISA Kit

    abx257574-96tests 96 tests
    EUR 637
    • Shipped within 5-12 working days.

    Human Neuroplastin (NPTN) ELISA Kit

    SEC666Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4731.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

    Human Neuroplastin (NPTN) ELISA Kit

    SEC666Hu-1x48wellstestplate 1x48-wells test plate
    EUR 477.3
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

    Human Neuroplastin (NPTN) ELISA Kit

    SEC666Hu-1x96wellstestplate 1x96-wells test plate
    EUR 639
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

    Human Neuroplastin (NPTN) ELISA Kit

    SEC666Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2575.5
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Neuroplastin (NPTN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Neuroplastin (NPTN) in tissue homogenates, cell lysates and other biological fluids.

    Human Neuroplastin (NPTN) ELISA Kit

    4-SEC666Hu
    • EUR 4782.00
    • EUR 2526.00
    • EUR 640.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Neuroplastin elisa. Alternative names of the recognized antigen: SDR1
    • GP55
    • GP65
    • SDFR1
    • np55
    • np65
    • Stromal Cell Derived Factor Receptor 1
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Neuroplastin (NPTN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Neuroplastin(NPTN)ELISA Kit

    QY-E04762 96T
    EUR 361

    Neuroplastin (NPTN) Antibody

    abx146042-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    20-abx006050
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    abx027055-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    abx027055-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    20-abx173801
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Neuroplastin (NPTN) Antibody

    20-abx177788
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Neuroplastin (NPTN) Antibody

    20-abx321072
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    20-abx321948
    • EUR 439.00
    • EUR 328.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Neuroplastin (NPTN) Antibody

    20-abx326686
    • EUR 314.00
    • EUR 244.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Rat Neuroplastin, Nptn ELISA KIT

    ELI-35323r 96 Tests
    EUR 886

    Mouse Neuroplastin, Nptn ELISA KIT

    ELI-39707m 96 Tests
    EUR 865

    Mouse Neuroplastin (NPTN) ELISA Kit

    abx390037-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Rat Neuroplastin (NPTN) ELISA Kit

    abx391703-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    ELISA kit for Human NPTN (Neuroplastin)

    ELK4704 1 plate of 96 wells
    EUR 432
    • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuroplastin (NPTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuroplastin (
    • Show more
    Description: A sandwich ELISA kit for detection of Neuroplastin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

    Human Neuroplastin (NPTN) Protein

    20-abx654543
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Human Neuroplastin (NPTN) CLIA Kit

    20-abx493824
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Nptn ELISA Kit| Rat Neuroplastin ELISA Kit

    EF019063 96 Tests
    EUR 689

    Nptn ELISA Kit| Mouse Neuroplastin ELISA Kit

    EF015676 96 Tests
    EUR 689

    NPTN ELISA KIT|Human

    EF007364 96 Tests
    EUR 689

    NPTN ELISA Kit (Human) (OKCD08220)

    OKCD08220 96 Wells
    EUR 975
    Description: Description of target: Neuroplastin is a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. The alpha and beta transcripts show differential localization within the brain.Neuroplastin is a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. The alpha and beta transcripts show differential localization within the brain.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

    NPTN ELISA Kit (Human) (OKDD00432)

    OKDD00432 96 Wells
    EUR 975
    Description: Description of target: This gene encodes a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.052 ng/mL

    Neuroplastin antibody

    70R-7282 50 ug
    EUR 467
    Description: Rabbit polyclonal Neuroplastin antibody raised against the middle region of NPTN

    Neuroplastin antibody

    70R-1874 100 ug
    EUR 377
    Description: Rabbit polyclonal Neuroplastin antibody raised against the middle region of NPTN

    Neuroplastin Polyclonal Antibody

    ES5530-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Neuroplastin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

    Neuroplastin Polyclonal Antibody

    ES5530-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Neuroplastin from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

    Neuroplastin Polyclonal Antibody

    ABP54531-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
    • Applications tips:
    Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

    Neuroplastin Polyclonal Antibody

    ABP54531-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
    • Applications tips:
    Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

    Neuroplastin Polyclonal Antibody

    ABP54531-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160
    • Applications tips:
    Description: A polyclonal antibody for detection of Neuroplastin from Human, Mouse, Rat. This Neuroplastin antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Neuroplastin at AA rangle: 80-160

    Neuroplastin Blocking Peptide

    33R-5985 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NPTN antibody, catalog no. 70R-1874

    Neuroplastin Blocking Peptide

    33R-8310 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NPTN antibody, catalog no. 70R-7282

    Anti-Neuroplastin antibody

    STJ94440 200 µl
    EUR 197
    Description: Rabbit polyclonal to Neuroplastin.

    NPTN siRNA

    20-abx903630
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NPTN siRNA

    20-abx926287
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NPTN siRNA

    20-abx926288
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    NPTN antibody

    10R-7067 100 ul
    EUR 726
    Description: Mouse monoclonal NPTN antibody

    NPTN antibody

    10R-7068 100 ul
    EUR 691
    Description: Mouse monoclonal NPTN antibody

    NPTN antibody

    10R-7069 100 ul
    EUR 691
    Description: Mouse monoclonal NPTN antibody

    NPTN Antibody

    1-CSB-PA008837
    • EUR 222.00
    • EUR 195.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
    Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

    NPTN Antibody

    1-CSB-PA016028ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

    NPTN Antibody

    1-CSB-PA016028ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against NPTN. Recognizes NPTN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

    ELISA-1 1
    EUR 202

    Human NPTN shRNA Plasmid

    20-abx958925
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    NPTN Recombinant Protein (Human)

    RP041734 100 ug Ask for price

    NPTN cloning plasmid

    CSB-CL016028HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 849
    • Sequence: atgtcgggttcgtcgctgcccagcgccctggccctctcgctgttgctggtctctggctccctcctcccagggccaggcgccgctcagaacgagccaaggattgtcaccagtgaagaggtcattattcgagacagccctgttctccctgtcaccctgcagtgtaacctcacctccag
    • Show more
    Description: A cloning plasmid for the NPTN gene.

    NPTN Rabbit pAb

    A7972-100ul 100 ul
    EUR 308

    NPTN Rabbit pAb

    A7972-200ul 200 ul
    EUR 459

    NPTN Rabbit pAb

    A7972-20ul 20 ul
    EUR 183

    NPTN Rabbit pAb

    A7972-50ul 50 ul
    EUR 223

    NPTN Polyclonal Antibody

    31395-100ul 100ul
    EUR 252

    NPTN Polyclonal Antibody

    31395-50ul 50ul
    EUR 187

    Anti-NPTN antibody

    STJ110279 100 µl
    EUR 277
    Description: This gene encodes a type I transmembrane protein belonging to the Ig superfamily. The protein is believed to be involved in cell-cell interactions or cell-substrate interactions. Alternative splicing results in multiple transcript variants.

    NPTN ORF Vector (Human) (pORF)

    ORF013912 1.0 ug DNA
    EUR 354

    Frit Kit

    FRIT-KIT 1each
    EUR 124
    Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

    NPTN Polyclonal Conjugated Antibody

    C31395 100ul
    EUR 397

    Rat NPTN shRNA Plasmid

    20-abx985858
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse NPTN shRNA Plasmid

    20-abx972619
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    NPTN Recombinant Protein (Rat)

    RP214388 100 ug Ask for price

    NPTN Recombinant Protein (Mouse)

    RP154784 100 ug Ask for price

    Column Packing Kit

    PACK-KIT 1pack
    EUR 1035
    Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

    NPTN sgRNA CRISPR Lentivector set (Human)

    K1449901 3 x 1.0 ug
    EUR 339

    PCR Mycoplasma Detection Kit

    M034-Kit Kit
    EUR 266

    Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

    CAS400A-KIT 1 kit (10 rxn)
    EUR 1110
    • Category: Cas9